GU_M.pdf

GU_M_pdf.txt

PAGE 1

BERMUDA GRASS ROOT ROT COMPLEXES ASSOCIATED WITH PLANT PARASITIC NEMATODES AND PYTHIUM SPECIES ON GOLF COURSES IN FLORIDA By MENGYI GU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2019

PAGE 2

© 2019 Mengyi Gu

PAGE 3

To m y beloved parents for making me be who I am, my husband for supporting me all the way, and my son for giving me courage to overcome difficulties

PAGE 4

4 ACKNOWLEDGMENTS I would like to gratefully and sincerely thank Dr. William T. Crow for his support, patience, and understanding during my six Florida. His mentorship was paramount in guiding me into the world of nematology, and providing a well rounded experience consistent with my long term career goals. I would Thomas M. Bean for teaching me the basic lab and fieldwork knowledge, and assisting my research. I would also like to thank my committee members, Dr. Phillip F. Harmon, Dr. Tesfamariam Mengistu, Dr. Larry W. Duncan and Dr. Md Ali Babar, for their input, valuable discussions, assistance and guidance on my way to my PhD degree. I would lik e to thank Dr. Soumi Joseph, without whose help, I could not finish the molecular identification work in my research. Finally, I would like to thank the UF Nematode Assay Lab and the UF/IFAS Plant Diagnostic Center for providing the support ing data for my research.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 ! LIST OF TABLES ................................ ................................ ................................ ............ 7 ! LIST OF FIGURE S ................................ ................................ ................................ .......... 9 ! LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ! ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 14 ! Why Study Golf Course Turfgrass Management? ................................ .................. 14 ! The Two Common Bermudagrass Root Problems in Florida ................................ .. 15 ! Pythium Root Rot ................................ ................................ ............................. 15 ! Nematodes ................................ ................................ ................................ ....... 16 ! Nematodes Associated Disease Complexes ................................ .......................... 17 ! Hypothesis of My Study ................................ ................................ .......................... 19 ! 2 PRELIMINARY DATA ................................ ................................ ............................. 22 ! Introducti on ................................ ................................ ................................ ............. 22 ! Nematodes Assay of Bermudagrass Root Rot Disease Samples ........................... 22 ! Materials and Methods ................................ ................................ ..................... 22 ! Result s ................................ ................................ ................................ ............. 23 ! Pythium Species Collection from Nematode Samples ................................ ............ 23 ! Materials and Methods ................................ ................................ ..................... 23 ! Results ................................ ................................ ................................ ............. 26 ! Summary ................................ ................................ ................................ ................ 27 ! 3 BERMUDAGRASS ROOT ROT DISEASE COMPLEX TEST ................................ 37 ! Introduction ................................ ................................ ................................ ............. 37 ! Material and Met hods ................................ ................................ ............................. 37 ! Host Plant Preparation ................................ ................................ ..................... 37 ! Experimental Design ................................ ................................ ........................ 38 ! Inocula Preparation ................................ ................................ .......................... 38 ! Data Collection and Analysis ................................ ................................ ............ 39 ! Results ................................ ................................ ................................ .................... 40 ! Pathogenicity Test of Three Pythium Isolates ................................ .................. 40 ! Belonolaimus longicaudatus Pythium Trial ................................ .................... 41 ! Meloidogyne graminis Pythium Trial ................................ .............................. 42 !

PAGE 6

6 Discussion ................................ ................................ ................................ .............. 43 ! Pathogenicity Test of Three Pythium Isolates ................................ .................. 43 ! Nematode Pythium Complexes ................................ ................................ ..... 43 ! Summary ................................ ................................ ................................ .......... 44 ! 4 PATHOGEN ATTRACTION TEST ................................ ................................ .......... 61 ! Introduction ................................ ................................ ................................ ............. 61 ! Materials and Me thods ................................ ................................ ............................ 62 ! Inocula Preparation ................................ ................................ .......................... 62 ! Greenhouse Attraction Test ................................ ................................ .............. 63 ! Lab Attraction Test ................................ ................................ ........................... 65 ! Data Ana lyses ................................ ................................ ................................ .. 66 ! Results ................................ ................................ ................................ .................... 67 ! Pythium Inoculated Roots Nematode ................................ ............................. 67 ! Nematode Infested Roots Pythium ................................ ................................ . 67 ! Discussion ................................ ................................ ................................ .............. 68 ! 5 ROOT EXUDATE METABOLOMIC TEST ................................ .............................. 77 ! Introduction ................................ ................................ ................................ ............. 77 ! Materials and Methods ................................ ................................ ............................ 78 ! Root E xudates Collection ................................ ................................ ................. 78 ! Root Exudates Analysis ................................ ................................ .................... 79 ! Results ................................ ................................ ................................ .................... 79 ! Discussion ................................ ................................ ................................ .............. 80 ! 6 CONCLUSION ................................ ................................ ................................ ........ 89 ! LIST OF REFERENCES ................................ ................................ ............................... 91 ! BIOGRAPHICAL SKETCH ................................ ................................ ............................ 99 !

PAGE 7

7 LIST OF TABLES Table page 2 1 List of plant parasitic nematode numbers in 50 cm 3 of soil from each sample with a positive diagnosis for bermudagrass Pythium root rot disease from May 2016 May 2017. ................................ ................................ ....................... 29 ! 2 2 Numbers of bermudagrass samples with a positive diagnosis of Pythium infection from which different nematode genera were r ecovered and those with nematode numbers exceeding risk thresholds. ................................ ........... 30 ! 2 3 The trimm ed consensus ITS sequence s of three Pythium isolates obtained from bermudagrass samples . ................................ ................................ ............. 31 ! 2 4 Population density of plant parasitic nematode genera/100 cm 3 of soil. ............ 32 ! 3 1 List of treatments in the Belonolaimus longicaudatus Pythium trial. ................ 46 ! 3 2 List of treatments in the Meloidogyne graminis Pythium trial. .......................... 47 ! 3 3 An ANOVA table from a GLM procedure for the Pythium isolates pathogenicity test in the Belonolaimus longicaudatus Pythium trial. ................ 48 ! 3 4 An ANOVA table from a GLM procedure for the Pythium isolates pathogenicity test in the Meloidogyne graminis Pythium trial. .......................... 49 ! 3 5 An ANOVA Table from a GLM procedure for data in the Belonolaimus longicaudatus Pythium trial. ................................ ................................ ............. 50 ! 3 6 An ANOVA Table from a GLM procedure for data in the Meloidogyne graminis Pythium trial. ................................ ................................ ..................... 51 ! 4 1 Results from a greenhouse attraction test evaluating the number of Belonolaimus longicaudatus around Pythium inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ..................... 70 ! 4 2 Results from a lab attraction test evaluating the number of Belonolaimus longicaudatus around Pythium inoculated (I) and u ninoculated (U) bermudagrass roots. ................................ ................................ ........................... 70 ! 4 3 Results from a greenhouse attraction test evaluating the number of Meloidogyne gramini s around Pythium inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ........................... 71 ! 4 4 Results from a lab attraction test evaluating the number of Meloidogyne graminis around Pythium inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ................................ .................. 71 !

PAGE 8

8 4 5 Results from a greenhouse attraction test evaluating the Pythium percent infection (%) on Belonolaimus longicaudatus inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ..................... 72 ! 4 6 Results from a lab attraction test evaluating Pythium mycelia growth on Belonolaimus longicaudatus inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ........................... 72 ! 4 7 Results from a greenhouse attraction test evaluating Pythium zoospore observation on Meloidogyne graminis inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ........................... 73 ! 4 8 Results from a greenhouse attraction test evaluating the Pythium percent infection (%) on Meloidogyne graminis inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ........................... 73 ! 4 9 Results from a lab attraction test evaluating Pythium myce lia growth on Meloidogyne graminis inoculated (I) and uninoculated (U) bermudagrass roots. ................................ ................................ ................................ .................. 73 ! 5 1 Metabolites observed in root exudates from six bermudagrasses samples. ....... 83 !

PAGE 9

9 LIST OF FIGURES Figure page 1 1 The 2012 2015 bermudagrass disease sample data from the UF/IFAS Plant Diagnostic Center. ................................ ................................ .............................. 21 ! 2 1 Numbers of plant parasitic nematode genera recovered from bermudagrass Pythium root rot disease samples. ................................ ................................ ...... 33 ! 2 2 Morphological features of Pythium spp. isolated from the UF Nematode Assay lab samples. ................................ ................................ ............................. 34 ! 2 3 Banding patterns for PCR products electrophoresed at 110 V for 25 min. ......... 35 ! 2 4 Evolutionary phylogenetic relationship among isolated pathogens and already known Pythium spp. ................................ ................................ ............... 36 ! 3 1 Containers in the bermudagrass root rot disease complex test. ......................... 52 ! 3 2 Pythium Percent infection (PPI) of three Pythium isolates in the pathogenicity test. ................................ ................................ ................................ ..................... 53 ! 3 3 Be rmudagrass root length in the pathogenicity test. ................................ ........... 54 ! 3 4 Effects of Belonolaimus longicaudatus on Pythium arrhenomanes inoculated bermudagrass. ................................ ................................ ................................ .... 55 ! 3 5 Effects of Belonolaimus longicaudatus on Pythium catenulatum inoculated bermudagrass. ................................ ................................ ................................ .... 56 ! 3 6 Effects of Belonolaimus longicaudatus on Pythium middletonii inoculated bermudagrass. ................................ ................................ ................................ .... 57 ! 3 7 Effects of Meloidogyne graminis on Pythium arrhenomanes inoculated bermudagrass. ................................ ................................ ................................ .... 58 ! 3 8 Effects of Meloidogyne graminis on Pythium catenulatum inoculated bermudagrass. ................................ ................................ ................................ .... 59 ! 3 9 Effects of Meloidogyne graminis on Pythium middletonii inoculated bermudagrass. ................................ ................................ ................................ .... 60 ! 4 1 U shape PVC containers applied in the greenhouse attraction test. ................... 74 ! 4 2 Bemudagrass sprigs pla nted in five ml pipette tips in the lab attraction test. ...... 74 ! 4 3 One example of bermudagrass roots with and without Pythium zoospor e attachment. ................................ ................................ ................................ ......... 75 !

PAGE 10

10 4 4 One example of nematode infected bermudagrass roots stopping Pythium mycelia growth. ................................ ................................ ................................ ... 76 !

PAGE 11

11 LIST OF ABBREVIATIONS AZI1 Azelaic acid induced 1 gene CMA Corn meal agar GABA Gamma aminobutyric acid GLM Generalized linear model ITS Internal transcribed sequence NCBI National Center for Biotechnology Information PART A Pythium selective media contain ingredients pimaricin, ampicillin, rifampicin, thiamine and corn meal agar PCR Polymerase chain reaction PPI Pythium percent infection RA Rosmarinic acid TAE Tris Acetate EDTA buffer USGA United States Golf Course Association UV Ultraviolet light WAS Week after sprigging

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BERMUDAGRASS ROOT ROT COMPLEXES ASSOCIATED WITH PLANT PARASITIC NEMATODES AND PYTHIUM SPECIES ON GOLF COURSES IN FLORIDA By Mengyi Gu May 2019 Chair: William T. Crow Major: Entomology and Nematology The fungus like oomycete Pythium causes Pythium root rot , one of the most common bermudagrass diseases on Florida golf courses. In a previous nematicide greenhouse experiment, creeping bentgrass growing in pots inoculated with sting nematod e easily acquired Pythium root rot. Plant parasitic nematodes , especially root knot nematode, were observed from most Pythium root rot disease samples received by the UF/IFAS Plant Diagnostic Center. Therefore, we hypothesized that plant parasitic nematode s might be associated with Pythium spp. i n causing bermudagrass root rot disease. This research focused on the effects of sting or root knot nematodes on root infection by three Pythium spp. ( P. arrhenomanes , P. catenulatum and P. middletonii ) on bermudagrass and their mycelia growth . Different nematodes and different Pythium spp. interacted with each other in different ways. Sting nematode increased root infection by low virulence P. catenulatum , and it might induce plant resistance to high vi rulence P. arrhenomanes . Root knot nematode reduced infection by either P. arrhenomanes or P. caten ulatum . We also found that bermudagrass roots infested with

PAGE 13

13 plant parasitic nematodes might have negative effects on growth of Pythium mycelia, whether the P ythium spp. is virulent or not. We observed increased levels of benzene sulfonic acid and aze laic acid in nematode infested bermudagrass root exudates , providing a possible explanation of the antagonistic effect s observed between nematode infested roots and Pythium spp. Benzene sulfonic acid provides an acidic environment which may inhibit Pythium mycelia growth. Aze laic acid is involved in the plant immune system and may induce plant resistance to Pythium spp. This study indicated bermudagrass root rot disease identification only based on Pythium isolation could be inaccurate. Sometimes plant parasitic nematodes are the major disease causal agents associated with avirulent or low virule nce Pythium spp. More efficient bermudagrass root rot disease management strat egies can be generated when taking both plant parasitic nematodes and Pythium spp. into consideration.

PAGE 14

14 CHAPTER 1 LITERATURE REVIEW Why S tudy Golf Course T urfgrass M anagement ? Turfgrass is found everywhere in daily life. It beautifies lawns and parks in our cities, provides safe playing surfaces on athletic fields like golf courses and football fields, and plays a role in dust control when planted along highways and airport runw ays . Turfgrass is also a commercial product when grown on sod farms. Turfgrass not only provides economic value and beauty to our lives (Morris, 2003), but also benefits our physical and mental health (Bauske and Waltz, 2013). Turf also is an important cro p based on acreage, Milesi et al. (2005) indicated that in the U.S. turfgrass covers over 4 0 million acres , which is 2% of the land in the continental U.S . The turf industry is valued $ 40 billion annually (Morris, 2003). Turf is the top one or two agricult ural commodities i n states such as Maryland, Pennsylvania, Florida, New Jersey, and North Carolina (Haydu et al., 2006). The turfgrass industry has had a huge an essen tial part in turfgrass industry because of its high economic value. There are 1,103 golf courses and 524 golf communities within the state. Numerous championship $11.0 billion, providing over 132,000 jobs, and $3.6 billion of wage income in 2013 (Anonymous, 2015). Because of the role golf industry plays in the state economy, golf course turfgrass management is very important in Florida. Bermudagrass ( Cynodon spp.) is th e most widely used turf species on U . S . golf courses (Lyman et al., 2007) due to its green color, medium to fine texture and excellent heat, wear, drought and salt tolerance (Beard, 2002). It is a warm season grass that

PAGE 15

15 spreads by rhizomes and stolons. Hyb rid bermudagrasses ( C. dactylon (L.) Pers. x C. transvaalensis Burtt Davy) is widely utilized on golf courses in tropical, subtropical, and temperate climate areas (Burton, 1964; Burton and Elsner, 1965; Reasor et al. , 2016). Research results indicate tha t turfgrass, including bermudagrass, is affected by many physiological (low cold and shade tolerance), and biological disorders like insects (including chinch bugs, mole cricket, etc.), and numerous pathogenic agents (in cluding fungal pathogens, plant parasitic nematodes, vi ruses, bacteria, etc.) (Smiley et al. , 2005). Understanding the relationships between turfgrass and these noninfectious and infectious agents provides more efficient strategies for turfgrass management. The Two Common B ermudagrass R oot P roblems i n F lorida Pyth ium spp. and plant parasitic nematodes are two of the most common root problem causal agents on bermudagrass in Florida. Pythium Root R ot Pythium diseases have become widespread on turfgrass since 1940s (Abad et al., 1994). Pyth ium root rot is a bermudagrass root disease caused by the soil borne pathogen Pythium species (Hodges and Coleman, 1985). The disease occurs in poorly drained conditions and high temperature and humidity environments (Smiley et al. , 2005). Symptoms of Pyth ium infected grass roots include reduced growth and small to large yellow or necrotic patches, a tan to brown discoloration may or may not be apparent on turf roots, crowns and stolons (Hodges and Coleman, 1985; Smiley et al. , 2005). Based on preliminary d ata provided by the UF/IFAS Plant Diagnostic Center, Pythium root rot is considered one of the major diseases on bermudagrass in Florida since 2012 (Figure 1 1). In the past few decades, about 50 Pythium species have been reported on turfgrass in the United States (Nelson and Craft, 1991 ; Abad et al. , 1994;

PAGE 16

16 Feng and Dernoeden, 1999). Species like P. graminicola , P. irregular , P. catenulatum , P. ultimum , P. aphanidermatum , and P. torulosum have been report ed from bermudagrass in Florida (Alfieri et al., 1994; Harmon, 2004; Stiles et al., 2007). Research results indicate that some species such as P. aristosporum are highly aggressive (causing 61 to 100% disease) to turfgrass; other species like P. irregulare are moderately aggressive (causing 21 to 60% disease) (Abad et al., 1994). Nematodes Plant parasitic nematodes are unsegmented roundworms, which are tiny and need to be observed through microscopes (Christie, 1959). They can cause severe economic loss on many crops such as citrus (Shokoohi and Duncan, 2018), strawberry (Deseager and Noling, 2017), turfgrass (Crow, 2001), etc. Based on feeding strategies, plant parasitic nematodes can be divided into migratory and sedentary endoparasites, and ectoparasites . Ectoparasites, such as Belonolaimus longicaudatus (sting nematode), usually cause short and stubby roots; sedentary endoparasites, like Meloidogyne graminis (turfgrass root knot nematode), usually cause galls on roots; and migratory endoparasites, for ex ample Hoplolaimus galeatus (lance nematode), usually cause dark and rotten looking roots. The golf course putting green root zone mix (a minimum 90% fine sand to fine gravel content) (USGA green section staff, 2018) recommended by the United States Golf C ourse Association (USGA) provides favorable environment for nematode population development. Plant parasitic nematodes, especially sting, root knot, and lance nematodes, cause severe problems on golf courses in Florida, (Crow, 2005). Belonolaimus longicaud atus feeds on turfgrass root tips or long turfgrass root sides and causes short and stubby root symptom. Meloidogyne graminis penetrates the root with

PAGE 17

17 its entire body and then form s a permanent feeding site. The infection results in minor elongated galls o n roots or swelling of the roots (Heald, 1969). Hoplolaimus galeatus causes damage to small feeder roots and lead s to the death of root tips (Lukens and Miller, 1973). The damage by plant parasitic nematodes to the root system is responsible for yellow , de clining, or dying patches of grass. Nematodes Associated Disease C omplexes Disease complexes have been studied since 19 th was initiated by Louis Pasteur and Robert Koch. The earliest reports regarding disease complexes were attributed to Pasteur, who observed that synergistic interaction of different microorganisms can led to a disease. Altho ugh the study of plant disease causal agent s is still mainly focused on individual pathogens, mounting evidence indicates there can be synergistic effects between different pathogens that cause plant diseases (Lamichhane and Venturi, 2015). In the past, re search was conducted on plant disease complexes involving several pathogens in same phylum, for example crown and root rot in turfgrass is a disease complex associated with Pythium species and Rhizoctonia species (Lucas and Mudge, 1997); or belonging to di fferent phyla, such as nematode fungus disease complexes. The roles that nematodes play in plant disease complexes have been summarized in several reviews of Powell (1963, 1971a, 1971b), Pitcher ( 1965, 1978), Bergeson (1972), Taylor (1979) , Mai and Abawi (1 987), Evans and Haydock (1993), Back et al. (2002) , and Williams on and Gleason (2003) . Nematode associated plant diseases have three components: nematode, host plants, and other pathogens. Fungi are one of the major plant pathogens known to interact wit h nematodes on causing plant diseases (Khan, 1993). Nematode fungus association s have been studied since

PAGE 18

18 the 1800s. Atkinson (1892) first reported Meloidogyne incognita increased the severity of Fusarium wilt caused by Fusarium oxysporum f. sp. vasinfectum . Nematodes may act as vectors of fungal pathogens, wounding agents, host modifiers, rhizosphere modifiers, or resistance breakers in causing plant diseases (Bergeson, 1972). Nematode fungus association s in disease complexes can be synergistic, antagonisti c, and neutral (Back et al., 2002). Synergistic pathogen interactions have been reported more frequently than the other pathogen interactions. Synerg i stic disease complexes have been observed on many crops , mainly associate with endoparasitic nematode s and wilt fungi or root rot pathogens. For example, root knot Fusarium complex on tomato (Jenkins and Coursen, 1957), Verticillium wilt Pratylenchus complexes on cotton and pepper (Mountain and McKeen, 1962; Olthof and Reynes, 1969), nematode Pythium compl exes on chrysanthemum (Johnson and Littrell, 1969), etc. On turfgrass, zoysiagrass decline caused by Gaeumannomyces graminis var . graminis was reported to be related with plant parasitic nematodes in Maryland (Juska, 1972). Morris et al. (2016) reported that Meloidogyne spp. interacted with Pythium aphanidermatum synergistically on cucumber damping off. Ahmed and Shahab (2017) indicated that Meloidogyne incognita increased root rot symptom s on lentil when inoculated ten days prior to or simultaneously with Fusarium solani (Mart.) Sacc. Some plant parasitic nematodes modify host plant tissue and make quantitative and qualitative changes in root exudates , making them more favorable to fungal germination, growth and reproduction. Meloidogyne spp., Rotylenchulus reniformis , and Hoplolaimus tylenchiformis delayed the maturation of cotton seedlings , and made them

PAGE 19

19 more susceptible to damping off by Pythium debrayanum and Rhizoctonia solani . On c otton , root knot gall exudate s increased the sporangia production of P. debrayanum and R. solani when compared to healthy cotton root exudates (Brodie and Cooper, 1964). Sikder et al. (2015) observed that Meloidogyne graminicola broke resistance to Pythium arrhenomanes on the Pythium resistant r ice cultivar Nipponbare suppress ing the pathway of salicylic acid biosynthesis . In some cases ectoparasitic nematodes act as wounding agents and can be involved in synergistic disease complexes; for instance, Belonolaimus longicaudatus F usarium wilt on c otton (Holdeman and Graham, 1953 ; Minton and Minton, 1966). A ntagonistic interactions between nematodes and fungi have also been reporte d. Infection of Meloidogyne javanica on tomato increase d the expression of genes associated with plant defense response to other pathogens (Lambert et al., 1999). Meloidogyne hapla suppressed alfalfa damping off caused by Phytophthora megasperma f. sp. medicaginis ( Gray et al., 1990 ). El B orai e t al. (2002 a and 2002b ) reported that root infection by Phytophthora nicotianae was reduced by Tylenchulus semipenetrans on citrus , possibly because T. semipenetrans protect s its feeding site by producing anti fungal chemicals. Pythium spp. were antagonistic to Meloidogyne spp. on rice and sugarcane ( Valle Lamboy and Ayala, 1980; Sikder et al., 2015; Verbeek et al. , 2016) . Manosalva et al. (2015) found that ascarosides produced by plant parasitic nematodes induced plants defense responses to many other pathogens including oomycetes. Hypothesis o f My S tudy Pythium root rot wa s acquired easily when creeping bentgrass was infested with B. longicaudatus . In many

PAGE 20

20 diagnoses of bermudagrass suffering from root dysfunction, B. longicaudatus and Pythium spp. occur concomitantly. This brings forward the question do plant parasitic nematode s predispose bermudagrass to Pythium root diseases The primary hypothesis of th is dissertation is that the plant parasitic nematodes B. longicaudatus and M. graminis have a synergistic association with Pythium spp. in causing root rot disease on bermudagrass.

PAGE 21

21 Figure 1 1. The 2012 2015 bermudagrass disease samp le data from the U F/IFAS Plant Diagnostic Center. X axis present s the disease observed in all received bermudagrass samples; Y axis present s the sample number of each disease. The numbers of received Pythium root rot samples ranked at the top every year from 2012 to 2015. 0 50 100 150 200 250 300 Pythium Root Rot No Pathogen Found Pythium Blight Bermudagrass Decline Leaf and Sheath Spot Bipolaris Leaf Blotch Other Diseases Sample No. 2012 2013 2014 2015

PAGE 22

22 CHAPTER 2 PRELIMINARY DATA Introduction Bermudagrass root rot disease caused by Pythium spp. is considered t he one of major disease s on Florida golf greens based on the 2012 2015 data (Figure 1 1 ) provided by the UF/IFAS Plant Diagnostic Center. According to previous greenhouse research experience, bent grass infested with sting nematode ( Belonolaimus longicaudatus ) easily acquires Pythium root rot disease . High plant parasitic nematode population densities were frequently observed on golf course greens that were diagnosed with Pythium root rot disease . (Crow, W.T. , pers. comm. ). In the literature review by Powell (1971 a ), plant parasitic nematodes associated with Pythium spp. led to root disease complex es on many crops , including tomato, tobacco, peach, sugarcane, corn , and chrysanthemum . B ermudagrass root rot disease may be associated with both Pythium spp. and plant parasitic nema todes. N ematode assay s of several bermudagra ss sample s that were positive for Pythium spp. infection were conducted to test the hypothesis. Additionally, Pythium species were isolated from nematode infested bermudagrass samples received by the Florida Ne m atode Assay lab . Three of these isolates were retained for use in future studies. Nematodes Assay of Bermudagrass Root Rot Disease Sample s Materials a nd Methods From May 2016 May 2017, soil from all bermudagrass Pythium root rot disease positive samples received by the UF/IFAS Plant Diagnostic Center we re collected for nematode assay. N ematodes were extracted from 50 cm 3 of well mixed sample of soil and roots using a modified mist chamber method (unpublished method developed by

PAGE 23

23 Dr. William T. Crow) for 72 hours . Then, ne matodes were identified to genus and counted using an Olympus CK30 inverted microscope at 20! magnification. Results A t otal of 34 bermudagrass root rot diseas e samples were received . Nematode data of each sample were listed in Table 2 1. P lant parasitic nem atodes were recovered from 30 of these samples ( 88% of received samples ) . In 19 of them ( 56% of received samples) the population density of at least one type nematode presented risk of nematode damage based on the risk thresholds used by the UF Nematode Assay Lab. Genera of plant parasitic nem atodes recovered from those Pythium positive samples included: Belonolaimus ( s ting nematode ) (9 samples , 26% of received samples ), Meloidogyne ( root knot nematode ) (23 samples , 67% of received samples ), Hoplolaimus ( lance nematode ) (17 samples , 50% of received samples ), and Helicotylenchus ( spiral nematode ) (13 samples , 38% of received samples ) were observed more frequent than the other plant parasitic nematodes (Table 2 2 , Figure 2 1 ). N ematode populatio n densities above threshold were observed in 44% of sting nematode , 61% of root knot nematode , and 29% of lance nem atode samples. Pythium S peci es C ollection from Nematode S amples Materials a nd Methods Five nematode diagnostic samples received by the Florid a N ematode Assay lab were processed for preliminary data of nematode Pythium associated with bermudagrass root rot disease . These samples originated from different golf greens on the Ke y Largo Executive Golf Club in T he Villages, FL. Nematodes were extracted from 100 cm 3 of well mixed sample soil by c entrifugal flotation technique (Jenkins, 1964) using a 38

PAGE 24

24 Scientific Inc., MA). P lant parasitic nematode numbers were identified to genus and counted. Pythium speci es were isolated from roots of these samples and identified using m orphologic al and molecular methods. Identified Pythium isolates were collected for future studies . Pythium species were isolated by Pythium s elective media (PART) developed by the UF/IFAS Plant Diagnostic Center. Corn meal agar ( CMA ) growth med ium (8.5 g in 500 ml of deionized water) was autoclaved at 121 ¡C for 20 minutes; when the medium was cooled to 55 ¡C in Fisher Versa Bath Model 130 ( Thermo Fisher Scientific , Waltham, MA ) , 0.25 g ampicillin (Sigma Aldrich Corporation, St. Louis, MO) , 0.015 g pimaricin ( Fisher Scientific International, Inc., Hampton, NH ) , 0.005 g rifampicin (Sigma Aldrich Corporation, St. Louis, MO) , and 0.0002 g thiamine (Sigma Aldrich Corpor ation, St. Louis, MO) were added . Approximately one cm sections of root tissue s exhibiting rot and discoloration symptoms were cut and surface sterilized by soak ing in 0.6 % sodium hypochlorite for 1 minute. Afte r rinsing in running deionized wat er for one minute , root sections were blotted dry on sterilized paper tower , plated on P ART media, and incubated for 3 5 days at 24 ¡C to allow pathogen growth. Pythium isolates were cultured on V8 juice agar , CMA, and St. Augustine grass leaf blades for three to f ive days, and then identified to genus based on the morphological feature s of hyphae , sporangia and oogonia (Van Der Plaats Niterink, 1981 ; Abad et al., 2004 ) . Each isolate was purified by cutting a 0. 25 cm 2 mycelia plug from the edge of a colony and subcultured onto CMA . Pure Pythium isolates were maintained at 24 ¡C for 7 days, and three 0 . 25 cm 2 mycelia plugs were placed in

PAGE 25

25 sterilized capped test tubes containing three sterilized hempseeds submerged in sterilized deionized water for long term storag e (Abad et al., 1994). Pythium isolate s were identified to species using a molecular method ( Levesque and de Cock, 2004; Klemsdal et al., 2008; Robideau et al., 201 1; Binagwa et al., 2016) . Prior to DNA extraction, each Pythium isolate was grown on CMA f or two week s at 24 ¡C to allow massive mycelia production . Fresh mycelia tissue was transferred to a 2 m l microcentrifuge tube with 500 a Sonicator Q700 ( Qsonica L.L.C, Newtown, CT ) for one minute. Gen omic DNA was extracted using Quick gDNA TM MiniPrep Kit ( Zymo Research , Irvine, CA ) . Polymerase chain reaction (PCR) amplification of the internal trans cribed sequence (ITS) regions was TCC GTA GGT GAA CCT GCG G TCC TCC GCT TAT TGA TAT GC ion volume of 25.0 contained 8.5 µL nuclease free water, 12.5 of 2X One Taq Hot Start MasterM ix (BioLabs, New England), 1.25 µL of ea ch primer (10 µM) an d 1.5 of DNA template . Amplification conditio ns were achieved in a BIO RAD MyCycler TM Thermal C ycler ( Bio Ra d Laboratories, Inc., Hercules, CA ) programmed for initial denaturation at 95¡C for 15 min, followed by 30 cycles of denaturation at 94¡C for 30 s ec , annealin g at 55¡C for 30 s ec and el ongation at 72¡C for one min. At the end of amplification reaction, a final extension step was accomplished at 72¡C for 10 min. PCR products were run at 1.5% agarose gels dissolved in 1! TAE (Tris Acetate EDTA buffer) concentration as the running solution followed with post st aining of ethidium bromide (0.5 µg/ml ). Electrophoretic migration was carried out for 25 min electrophoresed at 110 V. The amplified products were visualized and photographed under ultraviolet (UV) light. An

PAGE 26

26 Apex 100 bp ladder (Genesee Scientific Inc., San Diego, CA) was used to estimate the size of PCR products. PCR products with a size of 600 bp and above were sent to the UF Interdisciplinary Center for Biotec hnology Research for Sanger sequencing. Consensus ITS sequences of Pythium isolates were aligned and trimmed for quality using Geneious software , then compared with ITS sequences of known Pythium species available in the GenBank database by performing nucleotide blast search at the National Center for Biotechnology Information ( NCBI) website ( http://blast.ncbi.nlm.nih.gov/blast.c gi ). The MEGA 7 software was used for phylogenetic analysis. Results a nd were sequenced for phylogenetic classification according to their respective molecular sequences of the ribosomal fragments (Figure 2 3). The trimmed consensus ITS sequences of Pythium isolates from bermudagrass samples were listed in Table 2 3. Three d ifferent Pythium spp. were identified based on nucleotide blast results (Figure 2 4) . Pythium closest to P. aristosporum (99 % identity) and P. arrhenomanes (99 % identity) P. middletonii (94 % identity) and P. orthogonon (93 % identity) P. catenulatum (99 % identity) and P. angustatum (98 % identity) . Based on literature, P. aristosporum and P. arrhenomanes cannot be differe n tiated by molecular method s (Levesque and de Cock, 2004; Robideau et al., 2011) . The low percent similarity of the species.

PAGE 27

27 Morphological features ( Van Der Plaats Niterink, 1981; Abad et al., 2004 ) we re used to confirm Pythium species . I to P. arrhenomanes than P. aristosporum , because only proliferating and globose sporangia (Figure 2 2 A ) were observed in the isolate ; no oospore presented in any of these medium cultures even in grass blade cultures (Kerns and Tredway, 2010) . T he presence of aplerotic oospores, intercalary oogonia , monoclinous antheridia, and globose sporangia (Figure 2 2 B ) in makes it closest to P. middletonii ; the diameter of oospores was in the range 17 to 20 and the average was 18 . I P. catenulatum due to the observation of catenulate sporangia ( Figure 2 2 C ). also had a high sting nematode population density, over 50 sting nematode s per 100 cm 3 of soil (Table 2 4 ). Summary In the bermudagras s Pythium root rot disease positive samples diagnosed by the UF/IFAS Plant Diagnostic Center, plant parasitic nematodes were recovered from 88% of them and nematode numbers above thresholds were observed in 56% of them . Sting nematode, root knot nematode, and lance nematode appeared more frequ ent and abundant in these Pythium positive samples compa red to other plant parasitic nematodes. These three plant parasitic nematodes are considered three major nematode problems on bermudagrass golf green s in Florida (Crow, 2005). In the five nematode samples received by the UF Nematode Assay lab, Pythium isolates close ly related to P. arrhenomanes , P. middletonii , and P. catenulatum were collected; and two samples, from which P. arrhenomanes and P. catenulatum were isolated, had high sting nematode population densities. Pythium arrhenomanes and P.

PAGE 28

28 catenul atum are two common Pythium species found on turfgrass ( Smiley et al., 2005 ) . Pythium middletonii has not been reported on turfgrass. Based on t he high numbers of plant parasitic nematode s present in bermudagrass Pythium root rot disease samples , and the observation of common turfgrass Pythium species from bermudagrass samples with high nematode numbers , there is possibility that plant parasitic nematodes are associated with Pythium spp. in causing bermudagrass root rot disease.

PAGE 29

29 Table 2 1. List of p lant parasiti c ne matode numbers in 50 cm 3 of soil from each sample with a positive diagnosis for bermudagrass Pythium root rot disease from May 2016 May 2017 . Sample s Belonolaimus Sting nematode (5 * ) Meloidogyne Root knot nematode (40 * ) Hoplolaimus Lance nematode (20 * ) Helicotylenchus Spiral nematode (350 * ) Peltamigratus Spiral nematode (75 * ) Hemicriconemoides Sheathoid nematode (250 * ) Mesocriconema Ring nematode (250 * ) Dolichodorus Awl nematode (5 * ) "RT16 246" 0 985 12 0 3 0 0 0 "RT16 247" 0 603 0 3 0 0 0 0 "RT16 251" 15 54 0 2 0 0 0 0 "RT16 252" 0 3 0 0 0 0 0 0 "RT16 255" 12 2 6 46 0 0 0 0 "RT16 270" 0 2 0 4 0 0 0 0 "RT16 298" 0 19 11 30 0 1 0 0 "RT16 304" 0 623 14 0 0 0 13 0 "RT16 314" 0 940 35 0 0 0 0 0 "RT16 324" 1 0 21 0 0 0 0 0 "RT16 353" 1 0 65 0 0 0 0 0 "RT16 361" 1 31 1 0 0 0 0 0 "RT16 362" 0 485 0 0 0 0 0 0 "RT16 363" 5 1 4 0 0 0 1 0 "RT16 366" 0 49 0 0 0 0 0 0 "RT16 425" 0 49 1 0 0 0 0 0 "RT16 471" 26 0 0 2 0 0 0 0 "RT16 472" 0 0 1 0 0 0 0 0 "RT16 482" 0 32 9 3 0 0 0 0 "RT16 488" 3 0 0 0 0 0 0 0 "RT16 554" 1 69 8 7 0 9 0 0 "RT16 564" 0 117 26 3 0 0 1 0 "RT16 567" 0 3 0 1 0 0 0 0 "RT16 590" 0 0 0 0 0 0 0 0 "RT16 591" 0 4 0 2 0 0 0 0 "RT16 628" 0 0 0 0 0 0 0 0 "RT16 641" 0 0 0 0 0 0 0 0 "RT16 642" 0 0 0 0 1 0 0 0 "RT17 62" 0 0 1 0 0 0 0 95 "RT17 76" 0 110 0 2 0 0 0 0 "RT17 111" 0 147 53 0 0 0 0 0 "RT17 118" 0 691 5 0 0 0 0 0 "RT17 182" 0 0 0 0 0 0 0 0 "RT17 190" 0 1,128 0 1,050 0 0 0 0 * Nematode thresholds are based upon number per 50 cm 3 soil. Unpublished data used by the UF Nematode Assay lab .

PAGE 30

30 Table 2 2 . N umbers of bermudagrass samples with a positive diagnosis of Pythium infection from which different nematode genera were recovered an d those with nematode numbers exceeding risk thresholds . Belonolaimus Sting nematode (5 * ) Meloidogyne Root knot nematode (40 * ) Hoplolaimus Lance nematode (20 * ) Helicotylenchus Spiral nematode (350 * ) Peltamigratus Spiral nematode (75 * ) Hemicriconemoides Sheathoid nematode (250 * ) Mesocriconema Ring nematode (250 * ) Dolichodorus Awl nematode (5 * ) Total 9 23 1 7 13 2 2 2 1 Over threshold 4 14 5 1 0 0 0 1 * Nematode thresholds are based upon number per 50 cm 3 soil. Unpublished data used by the UF Nematode Assay lab .

PAGE 31

31 Table 2 3. The trimm ed consensus ITS sequence s of three Pythium isolates obtained from bermudagrass samples . Sample Edited ITS Sequence >GU2_ITS1 TGCGGAAGGATCATTACCACACCAAAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTG TGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCCGCAAGTGTAGTTAATTCTGTACGCG TGGTCTTCCGATGTCTTTTTAAACCCATTACTTAATACTGATCTATACTCCGAGAACGAAAG TTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAA GAACGCTGCGAA CTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTT TGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACAT CAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGATGTGAGGTGTCTCG CTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTT GTGTCTGAGAGAAGTGTGACCTTCGA ATGCGGTGATCTGTTTGGATCGCTTTGCGCGAGT GGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCG GCCCGACGTTGCAGCTGAGAGTGTGTGGTTTTCTGTTCTTTCCTTGAGGTGTACCTGTTT GTGTGAGGCAATGGTCTGAGCAAATGGTTATTGTGTGAGAGTGGTTATTGCTCTTGGACG CTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTA GTCTGTGGAATGAATGAAT TTTTATTTCGCGGGCGCTTTTCAATTTGGACCTGATATCAAGTAAGACTACCCGCTGAACT TAAGCATATCAATAAGCGGAGGAA >GU3_ITS1 GGATCATTACCACACCTAAAAACTATCCACGTGAACTGTATGATACGATTAGCGCCGTGAC GCGTGCTGCGGGTTTGTAAACGAATCTGTGGTGTGCGGGCTCGGCTGATCGAAGGCTCT TTCATTGCTGCGGGTGTGTGCTTTTCGGAGCGCGTGTTTTGCGGCTTTGTGGGCTGACTT ACTTTTTCAAACCCCTTACTTGAATGACTGATGTATACTGTGAGGACGAAAGTCTTTGCTTT GAACTAGATAACAA CTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTG CGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCAT ATTGCACTTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTACATCAACCTTGC CTCTCTTTGTCGGTGTAGTCCGGTTTGGAGACGAGCAGACTATGAAGTGTCTTGCGCGTA TTTGCCATTTCGTGTGAACGGCGCGAGT CCTTTTGAAACGACACGATCTCTTCTATTTGCC TTTAGCAACTCGCTTTGGTTTGAACGCATCGGTCTTGGAATCGTTTGCAGTCTCCGGCGA CCTTGGCTTTGGACATTATGGAGGGCACCTCACTTCGCGGTATGTTAAGCTCTTTGTGGC GGAACAATGTTGCGTTTGTGTGTGTGTGTTTCCGTCTTTGGCTTTGAGGTGTACTGTGAG GTTGTGGGCTTGAGTCCTTGTGCTGTGTGTCAGTAGCTCGGAG GCGGTGTTTTTGTTATT GGATTCTGCGCGTGTATTCGCGTGGGTAGAGAGTATGTATTTGGGAACGATTGTACTGCG CTCTCTTGTGGGGGGCGTGTGTATCTCAATTGGACCTGATATCAGACAAGACTACCCGCT G >GU5_ITS1 GCGGAAGGATCATTACCACACCATAAAAACTTTCCACGTGAACCGTTACAATTATGTTCTG TGCTCTCTCTCGGGAGAGCTGAACGAAGGTAGTGCCGCATGTATGTGCGGCGTCTGCCG ATGTACTTTTAAACCCATTACACTAATACTGAACTATACTCCGAGAACGAAAGTTTTTGGTT TTAATCAATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTG CGAACTGCGATACG TAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCA CATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTG CCTTTCTTTTTTTGTGTAGTCAAGGAGAGAAATGGCAGAATGTGAGGTGTCTCGCTGACTC CCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTAA GATGAAGTGTGACTTTCGAACGCAGTG ATCTGTTTGGATCGCTTTGCGCGAGTGGGCGAC TTCGGTTAGAACATTAAAGGAAGCAACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGAC TTTGCAGCTGACAGTGTGTTGTTTTCTGTTCTTTCCTTGAGGTGTACCTGTCTTGTGTGAG GCAATGGTCTGGGCAAATGGTTATTGTGTAGTAGAATTTTGCTGCTCTTGGGCGCCCTAC TCGTAGGGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGC GGGGGATGTATTTCTCTT GCGGGCGCATTTTCAATTTGGACCTGATATCAAGTAAGATTACCCGCTGA

PAGE 32

32 Table 2 4 . Population density of plant parasitic nematode genera/ 100 cm 3 of soil . Samples Belonolaimus Sting nematode (10 * ) Hoplolaimus Lance nematode (40 * ) Helicotylenchus Spiral nematode (700 ) * Caloosia Sheath nematode (150 * ) Mesocriconema Ring nematode (500 * ) "1641" 17 0 0 0 29 "1642" 59 0 0 0 38 "1643" 26 15 153 9 41 "1645" 27 31 72 0 116 "1651" 58 0 2 0 156 * Nematode thresholds are based upon number per 100 cm 3 soil. Unpublished data used by the UF Nematode Assay lab .

PAGE 33

33 Figure 2 1 . Numbers of plant parasitic nematode genera recovered from bermudagrass Pythium root rot disease samples. Bars represent the number of samples where each genus of nematode was detected. White re presents the number of samples, in whic h nematode population density was below threshold; black re presents the number of samples, in which the nematode population density was over thresho ld . N ematode thresholds on bermudagrass are based upon number per 50 cm 3 soil (u npublished data used by the UF Nematode Assay lab ). 0 5 10 15 20 25 B e l o n o l a i m u s ( 5 ) M e l o i d o g y n e ( 4 0 ) H o p l o l a i m u s ( 2 0 ) H e l i c o t y l e n c h u s ( 3 5 0 ) P e l t a m i g r a t u s ( 7 5 ) H e m i c r i c o n e m o i d e s ( 2 5 0 ) M e s o c r i c o n e m a ( 2 5 0 ) D o l i c h o d o r u s ( 5 ) N u m b e r o f s a m p l e s O ve r t h re sh o l d Be l o w t h re sh o l d ! " # $ % $ # & ' ( ) * ( 5 ) + " # $ ' , $ . % " ( 4 0 ) / $ 0 # $ # & ' ( ) * ( 2 0 ) / " # ' 1 $ 2 . # " % 1 3 ) * ( 3 5 0 ) 4 " # 2 & ( ' 5 & 2 ) * ( 7 5 ) / " ( ' 1 5 ' 1 $ % " ( $ ' , " * ( 2 5 0 ) + " * $ 1 5 ' 1 $ % " ( & ( 2 5 0 ) 6 $ # ' 1 3 $ , $ 5 ) * ( 5 )

PAGE 34

34 A B C Figure 2 2 . Morphological features of Pythium spp. isolated from the UF Nematode Assay lab samples. A) Proliferating and globose sporangia observed in Aplerotic oospores, i ntercalary oogonia , monoclinous antheridia, and globose sporangia ; C) Catenulate sporangia .

PAGE 35

35 F igure 2 3 . Banding patterns for PCR products electrophoresed at 110 V for 25 min. L = Apex 100 bp ladder . Ampli fi cation pro ducts from massive fungal isolate mycelia obtained using primers ITS1 and ITS4 . L 1641 1642 1643 1645 1651

PAGE 36

36 Fi gure 2 4 . Evolutionary phylogenetic relationship among isolated pathogens and already known Pythium spp. Generated based on ITS ribosomal DNA sequences aligned by ClustaIW and constructed by neighbor joining tree . The associated taxa were clustered together in the bootstrap test (500 replicates) , and the percentage of replicate trees were shown next to the branches . Phylogenetic analyses were conducted in MEGA7 .

PAGE 37

37 CHAPTER 3 BERMUDAGRASS ROOT ROT DISEASE COMPLEX TEST Introduction The hi gh frequency of p lant parasitic nematode detection in nematode assay s of the pre test bermudagrass root rot disease positive samples indicated Belonolaimus spp. (sting nematode), Meloidogyne spp. (root knot nematode), and Hoplolaimus spp. (lance nematode), might be associa te d with Pythium species causing bermudagrass root rot disease. Our hypothesis was that plant parasitic nematodes have synergistic effects on bermudagrass root rot disease caused by Pythium spp. Based on literature, different Pythium species have varying virulence on different turfgrasses (Abad et al., 1994; Stiles et al., 2007). For example, P. aphanidermatum was highly aggressive (causing 61 100% disease) on both Poa trivialis and Lolium perenne ; while P. irregular e was m oderately aggressive (causing 21 60% disease) on P. trivialis and caused low level of disease (causing 1 20 % disease ) on L. perenne . There were two objectives in this experiment. First, to determine the virulence of the three Pythium isolates obtained from the UF Nemato de Assay lab sample s on Cynodon spp.). Second, to determine if two different plant parasitic nematodes ( B. longicaudatus and M. graminis ) increase the incidence and severity of Pythium root rot diseases on bermudagrass . Material a nd Methods Host Plant P reparation ed in individual 10 ml pipette tips ( Fisher Scientific International, Inc., Hampton, NH ) filled with 15 cm 3 autoclaved USGA specification sand (USGA green section staff, 2018) (Figure 3 1A) ; or

PAGE 38

38 bermudagrass sprigs with two nodes each were planted in each 5 cm diameter and 15 cm height PVC pipe containers filled with 30 0 cm 3 sterilized USGA specification sand (Figure 3 1B) . The turf sprigs were maintained in a gre enhouse by irrigating with 1.5 cm of water three times daily and fertilizing with one ml (for pipette tip) or 50 ml (for PVC pipe) Miracle Gro Water Soluble All Purpose Plant Food (Scotts Miracle Gro Products, Inc., Marysville, OH) once biweekly at 5 g fer tilizer /L solution . Experimental D esign Belonolaimus longicaudatus and M. graminis were tested in separate experiments for their effects on infection and damage by each of the three Pythium species on bermudagrass. Nematode and Pythium inoculations occurred on either 4 or 5 weeks after sprigging (WAS). Ea ch experiment had 9 treatments: an uninoculated control and 8 treatments that were inoculated with either the nematode or the Pythium sp p . individually, or together on the same day , or separately one week apart (Tables 3 1; 3 2). Each of the three Pythium species experiments for each nematode were conducted concurrently and shared the uninoculated control and nematode only treatments. This allowed the relative infectivity and pathogenici ty to be compared among the Pythium species. The B. longicaudatus experiment was conducted twice in pipette tips with ten blocks each time and once in PVC pipe container s with four blocks. The M. graminis experiment was conducted three times in PVC pipe co ntainer s with four blocks. All experiments used a randomized block design. Inocula Preparation Plant parasitic nematode inocula were extracted using a modified mist chamber method ( unpublished method developed by Dr. William T. Crow ) for 72 hours. Belonolaimus longicaudatus inoculum was cultured on St. Augustinegrass

PAGE 39

39 ( Stenotaphrum secundatum ) and M. graminis inoculum was cultured on bermudagrass. Each pipette tip was inoculated with 15 B. longicaudatus ; and each PVC pipe container was inoculated wit h either 50 B. longicaudatus or 500 M. graminis . Three Pythium isolates, Pythium arrhenomanes , P. middletonii , and P. catenulatum , were used as Pythium inocula. Each Pythium inoculum was prepared by incubating mycelia plugs wit h sterilized St. Augustinegra ss leaves in sterilized deionized water at the rate of three three mm mycelia plugs for every six 0.5 cm St. Augustinegrass blades. Pythium inocula were incubated under continuous fluorescent light at 24¡C for three days. Inoculation was performed by buryi ng inoculum ( Pythium colonized grass blade) at a 0.5 cm depth. Each pipette tip was inoculated with one Pythium colonized grass blade; each PVC pipe container was inoculated with four Pythium colonized grass blades. Data Collection and A nalysis Data were collected eight weeks after grass sprigging. In both B. longicaudatus Pythium and M. graminis Pythium tri als, root length was assessed using WinRHIZO equipment and software (Pang et al., 2011) followed by Pythium percent infection measurement . Roots were gently massaged in deionized water to remove sand, and then surface sterilized using the 0.6% sodium hypochlorite method mentioned in Chapter 2. Clean roots of each sample were cut into sections and four root sections were plated on one 100 cm diameter petri dish (Fisher Scientific International, Inc., Hampton, NH) containing PART medium for Pythium isolation. The Pythium percent infection was calculated by isolates number / 4 (number of root sections per plate) * 100 % .

PAGE 40

40 All statistical analyse s were performed using SAS ¨ 9.4 (SAS Institute Inc., Cary, NC). Data from the three repetitions of each experiment were analyzed using the generalized linear model (GLM) . If repetition was not significant ( P > 0. 1 ), the data from the repetitions were combi ned for analysis; if repetition was significant ( P ), data in each repetition were analyzed separately. Data was subjected to analysis of variance range test ( P 0.1). Results Pathogenicity Test o f T hree Pythium I solates Treatment Pa 4 ( P. arrhenomanes inoculated 4 WAS) had higher ( P per cent infection than treatments Pc 4 ( P. catenulatum inoculated at 4 WAS) and Pm 4 ( P. middletonii inoculated 4 WAS) in the B. longicaud atus Pythium trial (Table 3 3; Figure 3 2 A ) and Repetitions 2 and 3 of the M. graminis Pythium trial (Table 3 4; Figure 3 2 B ); Treatment Pa 5 ( P. arrhenomanes inoculated 5 WAS) had si milar results (Table s 3 3 and 3 4; Figure 3 2) when compared with treatments Pc 5 ( P. catenulatum inoculated 5 WAS) and Pm 5 ( P. middletonii inoculated 5 WAS). Pythium percent infection of both P. catenulatum (treatments Pc4 and Pc 5) and P. middletonii (treatments Pm4 and Pm 5) were low (less than 20%) i n the B. longicaudatus Pythium trial ( Table 3 3; Figure 3 2 A ); in the M. graminis Pythium trial, P. catenulatum had higher root percent infection (61% 100% ) in Repetitions 1 (treatments Pc4 and Pc5) and 3 (treatment Pc 4), moderate root percent infect ion (21% 60 %) in Repetitions 2 (treatment Pc4) and 3 (treatment Pc 5), and no infection in treatmen t Pc 5 in Repetition 2 (Table 3 4; Figure 3 2 B ). Pythium middletonii had low root percent infection in both B.

PAGE 41

41 longicaudatus Pythium and M. graminis Pyth ium trials (Table s 3 3 and 3 4; Figure 3 2). Treatment Pa 4 reduced bermudagrass root length compared to the untreated control ( P both B. longicaudatus Pythium (Table 3 3 ; Figure 3 3 A) and M. graminis Pythium (Table 3 4; Figure 3 3B) trial s. Treatment Pc 5 increased ( P root length in Repetitions 2 and 3 of the B. longicaudatus Pythium trial (Table 3 3; Figure 3 3A) and in Repetition 1 of the M. graminis Pythium trial ( Table 3 4; Figure 3 3B ). Root e ffects by P. middletonii were not observed in either tr ial. In both trials, treatment Pa 4 caused root damage similar to tr eatment B 4 ( B. longicaudatus ino culated 4 WAS) or treatment M 4 ( M. graminis inoculated 4 WAS) ( Table s 3 3 and 3 4; Figure 3 3). Belono laimus longicaudatus Pythium T rial Among those treatments inoculated with P. arrhenomanes , Pythium percent infect ion of treatment B4Pa 5 ( B. longicaudatus inoculated 1 week before P. arrhenomanes ) was less ( P 5 ( P. arrhenomanes inoculated 5 WAS) (Table 3 5; Figure 3 4A) ; root length of treatment B5Pa 4 ( B. longicaudatus inoculated 1 week after P. arrhenomanes ) was greater ( P 4 ( P. arrhenomanes inoculat ed 4 WAS) in Repeti tions 1 and 2 (Table 3 5; Figure 3 4 B ). In the P. catenulatum inoculated treatments, B5Pc 4 ( B. longicaudatus inoculated 1 week after P. catenulatum ) had higher ( P Pythium percent infection than Pc 4 ( P. catenulatum inoculated 4 WAS) in Repetitions 1 and 2 ; no P. catenulatum root infection was obs erved in Repetition 3 (Table 3 5; Figure 3 5 A). T reatment BPc 4 ( B. longicaudatus and P. catenulatum inoculated together 4 WAS) had greater root length

PAGE 42

42 than treatment Pc 4 ( P petition 1, and than treatment B 4 ( B. longicauda tus inoculated 4 WAS) in Repetitions 1 and 2 (Table 3 5 , Figure 3 5 B ). Base d on data presented in Table 3 5 and Figure 3 6, effects of B. longicaudatus on Pythium percent infection and root length of P. middletonii inoculated bermudagrass were not consist ent in three repetitions. Meloidogyne graminis Pythium T rial In the M. graminis P. arrhenomanes experiment, Pythium pe rcent infection from treatment M5Pa 4 ( M. graminis inoculated 1 week after P. arrhenomanes ) was less ( P 4 ( P. arrhenomanes inoculated 4 WAS). Root length results were not consistent am ong three repetitions (Table 3 6; Figure 3 7). Among treatments including P. catenulatum , treatment Pc 4 ( P. catenulatum inoculated 4 WAS) had greater ( P Pythium per cent in fection than treatment MPc 4 ( M. graminis and P. catenulatum inoculated together 4 WAS) in all three repetitions (Table 3 6; Figure 3 8A); the Pythium percent infection of treatment M5Pc 4 ( M. graminis inoculated 1 week after P. catenulatum ) was less ( P 1) than treatment Pc 4 in Repetitions 2 and 3 (Table 3 6; Figure 3 8A) . When compared with treatment Pc 5 ( P. catenulatum inoculated 5 WAS), treatment MPc 5 ( M. graminis and P. catenulatum inoculated together 5 WAS) had greater ( P Pythium percent infection in Rep etition 3 (Table 3 6; Figure 3 8A) . The root length of treatment RC4 was less than that of treatment Pc 4 ( P n Repetitions 2 and 3 (Table 3 6 , Figure 3 8 B ). Based on data presented in Table 3 6 and Figure 3 9, effects of M. graminis on Pythium percent infection and root length of P. middletonii inoculated bermudagrass were not consistent among the three repetitions.

PAGE 43

43 Discussion Pathogenicity T est of T hree Pythium I solates Results from the Pythium pathogenicity test indicate that P. arrhenomanes had the greatest bermudagrass root infection and P. middletonii had the lowest root infection among the three species tested. Bermudagrass root length was reduced significantly only when P. arrhenomanes was inoculated at 4 WAS. Taking Pythium infection and root length results together into consideration suggests that P. arrhenomanes is highly virulent on bermudagrass, P. catenulatum is mildly virulent on bermudagrass, and P. middletonii is a virulent on b ermudagrass . The results of the pathogenicity test were similar to observations in other studies. Abad et al. (1994) reported that all isolates of P. arrhenomanes tested caused >60% disease on bentgrass; P. catenulatum is considered a weak bermudagrass pat hogen (Smith et al., 1989; Couch, 1995). Nematode Pythium C omplexes When plant parasitic nematodes were introduced into Pythium bermudagrass system, instead of increasing disease incidence and severity, each nematode had different effects on the infectio n by the different Pythium spp. and on bermudagrass root health. Belonolaimus longicaudatus reduced infection by P. arrhenomanes when inoculated one week before Pythium inoculation; it increased bermudagrass root length when inoculated one week after Pythium inoculation. Similar to B. longicaudatus , M. graminis reduced root infection by P. arrhenomanes when inoculated one week after Pythium inoculation. Bermudagrass root resistance to P. arrhenomanes might also be induced by M. graminis , however, n o ro ot effect was observed in M. graminis P. arrhenomanes complex. These observations indicate that B. longicaudatus and M.

PAGE 44

44 graminis might have antagonistic effects against highly virulent P. arrhenomanes and reduce the root damage caused by the Pythium spp. Antagonistic effects may due to indirect (plant resistance induced by plant parasitic nematodes) or direct ( anti fungal chemicals ) pathogen interactions. The s mall molecules ascarosides produced by plant parasitic nematodes induced gene expression associa ted with plant defense response and activated salicylic acid and jasmonic acid mediated signaling pathways ( Manosalva et al., 2015 ). N ematodes also might inhibit Pythium directly, as with e ggs of Tylenchulus semipenetrans that produce anti fungal chemical s to inhibit the mycelial growth of Phytophthora nicotianae and Fusarium solani (EI Borai et al., 2002a). Infection by P. catenulatum on bermudagrass was increased when B. longicaudatus was involved , however, infection was reduced when roots were inoculate d with M. graminis at the same time . Belonolaimus longicaudatus , an ectoparasitic that feed s on the root cortex, might wound roots and leave openings for P. catenulatum infection (Bergeson, 1972). Similar to P. arrhenomanes , t he reduction of P. catenulatum infection by M. graminis might be caused by induced plant resistance or anti fungal chemical released by nematodes. The results of nematode P. middletonii complexes were not consistent. In most repetitions, no Pythium infection was observed. The occasional observation of Pythium infection might be due to wound ing caused by nematodes providing entrance for the Pythium . Summary Results of the pathogenicity test confirmed pathogenicity of the three Pythium isolates. Pythi um arrhenomanes is highly aggressive on bermudagrass and can cause severe root damage; P. catenulatum is a week pathogen on bermudagrass, which may

PAGE 45

45 not lead to root length reduction; P. middletonii is not considered a bermudagrass pathogen. When nematodes and Pythium were studi ed together, different from our hypothesis, no synergistic effects but antagonistic effects were observed when either nemato de interact ed with high virulent P. arrhenomanes on bermudagrass. Therefore, b ermudagrass root rot disease identification only based on Pythium isolation results without species determination can be inaccurate. In the cases of P. catenulatum and P. middletonii , sometimes plant parasitic nematodes are the primary c ausal agent of turf root damage and the associated Pythium infection may be from low virulence or avirulent strains. Accurate disease causal agent identification provides better management strategies for golf cour se superintendents. Based on our studies , Pythium species id entification and nematode assay are recommended when a positive Pythium infection occurs . Sometimes plant pa rasitic nematodes instead of Pythium cause the problem . More efficient management strategies can be generated when take both turf pathogens into con sideration.

PAGE 46

46 Table 3 1. List of treatments in the Belonolaimus longicaudatus Pythium trial . Treatment The 1 st inoculation (4 week after grass sprigging) The 2 nd inoculation (5 week after grass sprigging) B 4 B. longicaudatus Pa 4 P. arrhenomanes Pc 4 P. catenulatum Pm 4 P. middletonii BPa 4 B. longicaudatus + P. arrhenomanes BPc 4 B. longicaudatus + P. catenulatum BPm 4 B. longicaudatus + P. middletonii B 5 B. longicaudatus Pa 5 P. arrhenomanes Pc 5 P. catenulatum Pm 5 P. middletonii BPa 5 B. longicaudatus + P. arrhenomanes BPc 5 B. longicaudatus + P. catenulatum BPm 5 B. longicaudatus + P. middletonii B4Pa 5 B. longicaudatus P. arrhenomanes B4Pc 5 B. longicaudatus P. catenulatum B4Pm 5 B. longicaudatus P. middletonii B5Pa 4 P. arrhenomanes B. longicaudatus B5Pc 4 P. catenulatum B. longicaudatus B5Pm 4 P. middletonii B. longicaudatus U Uninoculated c ontrol Uninoculated c ontrol

PAGE 47

47 Table 3 2. List of treatments in the Meloidogyne graminis Pythium trial . Treatment The 1 st inoculation (4 week after grass sprigging) The 2 nd inoculation (5 week after grass sprigging) M 4 M. graminis Pa4 P. arrhenomanes Pc4 P. catenulatum Pm4 P. middletonii MPa 4 M. graminis + P. arrhenomanes MPc 4 M. graminis + P. catenulatum MPm 4 M. graminis + P. middletonii M 5 M. graminis Pa5 P. arrhenomanes Pc5 P. catenulatum Pm5 P. middletonii MPa 5 M. graminis + P. arrhenomanes MPc 5 M. graminis + P. catenulatum MPm 5 M. graminis + P. middletonii M4Pa 5 M. graminis P. arrhenomanes M4Pc 5 M. graminis P. catenulatum M4Pm 5 M. graminis P. middletonii M5Pa 4 P. arrhenomanes M. graminis M5Pc 4 P. catenulatum M. graminis M5Pm 4 P. middletonii M. graminis U Uninoculated control Uninoculated control

PAGE 48

48 Table 3 3. An ANOVA t able from a GLM procedure for the Pythium isolates pathogenicity test in the Belonolaimus longicaudatus Pythium trial . Treatments only inoculated with one pathogen and uninoculated control in Table 3 1 were selected for analyses . Total Repetition 1 Repetition 2 Repetition 3 Dependent Variable Source F Value Pr > F F Value Pr > F F Value Pr > F F Value Pr > F PPI * Repetition 0.37 0.6891 Block 0.77 0.6426 Treatment 42.35 <.0001 Model 18.20 <.0001 Root length Repetition 63.41 <.0001 Block 0.44 0.9093 0.05 1.0000 4.39 0.0135 Treatment 2.82 0.0090 7.72 <.0001 5.98 0.0003 Model 11.43 <.0001 1.56 0.0996 3.81 <.0001 5.55 0.0002 * Dependent variable , Pythium percent infection .

PAGE 49

49 Table 3 4 . An ANOVA t able from a GLM procedure for the Pythium isolates pathogenicity test in the Meloidogyne graminis Pythium tr ial. Treatments only inoculated with one pathogen and uninoculated control in Table 3 2 were selected for analyses . Total Repetition 1 Repetition 2 Repetition 3 Dependent Variable Source F Value Pr > F F Value Pr > F F Value Pr > F F Value Pr > F PPI * Repetition 2.40 0.0960 Block 0.34 0.7961 1.69 0.1953 1.69 0.1953 Treatment 10.47 <.0001 13.31 <.0001 18.44 <.0001 Model 16.36 <.0001 7.69 <.0001 10.14 <.0001 13.87 <.0001 Root length Repetition 21.87 <.0001 Block 0.98 0.4199 1.05 0.3876 2.97 0.0522 Treatment 9.55 <.0001 2.39 0.0469 1.50 0.2091 Model 6.39 <.0001 7.21 <.0001 2.03 0.0716 1.90 0.0914 * Dependent variable , Pythium percent infection .

PAGE 50

50 Table 3 5 . An ANOVA Table from a GLM procedure for data in the Belonolaimus longicaudatus Pythium trial . Data of three Pythium isolates were analyzed separately. Treatments and uninoculated control were listed in Table 3 1 . Total Repetition 1 Repetition 2 Repetition 3 Isolate Dependent Variable Source F Value Pr > F F Value Pr > F F Value Pr > F F Value Pr > F Pythium arrhenomane s PPI * Repetition 1.92 0.1496 Block 1.54 0.1376 Treatment 26.42 <.0001 Model 12.02 <.0001 Root length Repetition 61.41 <.0001 Block 0.92 0.5145 0.56 0.8233 1.15 0.3479 Treatment 3.10 0.0046 9.43 <.0001 2.05 0.0828 Model 9.77 <.0001 1.95 0.0270 4.74 <.0001 1.81 0.1090 Pythium catenulatum PPI * Repetition 11.06 <.0001 Block 0.81 0.6121 0.68 0.7213 0.00 0.0000 Treatment 3.93 0.0007 2.97 0.0066 0.00 0.0000 Model 4.05 <.0001 2.82 0.0084 1.77 0.0516 0.00 0.0000 Root length Repetition 66.22 <.0001 Block 0.80 0.6206 1.01 0.4398 1.23 0.3206 Treatment 5.27 <.0001 5.05 <.0001 1.48 0.2178 Model 11.00 <.0001 2.90 0.0009 3.04 0.0006 1.41 0.2320 Pythium middletonii PPI * Repetition 8.41 0.0003 Block 0.00 0.0000 0.56 0.8240 0.95 0.4338 Treatment 0.00 0.0000 2.91 0.0075 0.95 0.4941 Model 2.11 0.0059 0.00 0.0000 1.69 0.0661 0.95 0.5124 Root length Repetition 27.28 <.0001 Block 3.07 0.0037 1.18 0.3204 2.16 0.1191 Treatment 3.32 0.0028 6.69 <.0001 0.89 0.5429 Model 4.37 <.0001 3.10 0.0004 3.77 <.0001 1.23 0.3192 * Dependent variable , Pythium percent infection .

PAGE 51

51 Table 3 6 . An ANOVA Table fr om a GLM procedure for data in the Meloidogyne graminis Pythium trial. Data of three Pythium isolates were analyzed separately. Treatments and uninoculated control were listed in Table 3 2 . Total Repetition 1 Repetition 2 Repetition 3 Isolate Dependent Variable Source F Value Pr > F F Value Pr > F F Value Pr > F F Value Pr > F Pythium arrhenomane s PPI * Repetition 1.04 0.3593 Block 1.45 0.2325 Treatment 24.83 <.0001 Model 15.86 <.0001 Root length Repetition 16.26 <.0001 Block 1.78 0.1779 0.72 0.5513 5.43 0.0054 Treatment 4.28 0.0026 0.87 0.5536 1.68 0.1560 Model 4.21 <.0001 3.60 0.0042 0.83 0.6139 2.70 0.0203 Pythium catenulatum PPI * Repetition 21.80 <.0001 Block 3.39 0.0353 1.49 0.2418 1.15 0.3483 Treatment 11.88 <.0001 2.25 0.0592 10.49 <.0001 Model 8.95 <.0001 9.25 <.0001 2.05 0.0691 7.94 <.0001 Root length Repetition 18.53 <.0001 Block 0.61 0.6128 0.22 0.8823 3.69 0.0256 Treatment 3.06 0.0159 3.67 0.0063 4.47 0.0020 Model 6.82 <.0001 2.39 0.0357 2.73 0.0192 4.26 0.0015 Pythium middletonii PPI * Repetition 0.50 0.6096 Block 2.02 0.1162 Treatment 0.88 0.5326 Model 1.09 0.3794 Root length Repetition 22.93 <.0001 Block 0.50 0.6882 0.21 0.8883 1.45 0.2525 Treatment 6.65 0.0001 1.32 0.2815 1.49 0.2125 Model 5.56 <.0001 4.97 0.0005 1.02 0.4619 1.48 0.2031 * Dependent variable , Pythium percent infection .

PAGE 52

52 A B Figure 3 1. Containers in the bermudagrass root rot disease complex test. A) 10 ml pipette tips. B) 5 cm diameter and 15 cm height PVC pipes.

PAGE 53

53 A B Figure 3 2 . Pythium Percent infection (PPI) of three Pythium isolates in the pathogenicity test. Each bar is a treatment treatment mean . Means followed by common letters are not range test ( P Error bar represents standard error of each treatment . A) PPI results of Belonolaimus longicaudatus Pythium trial. Treatments are listed in Table 3 1. Data of all three repetitions were combined ( P > 0.05) (n=24 ). B) PPI results of Meloidogyne graminis Pythium trial. Treatments are listed in Table 3 2. Because data was significant different among repetitions ( P 0.05), each repetitio n was analyzed separately (n = 4 ). 0 0.2 0.4 0.6 0.8 1 1.2 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! B4 Pa 4 Pc4 Pm4 U B5 Pa 5 Pc5 Pm5 a b b b b b a b b 100 80 60 40 20 0 0.2 0.4 0.6 0.8 1 1.2 Repetition 1 Repetition 2 Repetition 3 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! M4 Pa 4 Pc4 Pm4 U M5 Pa 5 Pc5 Pm5 100 80 60 40 20 c a ab c c c b a c c a b c c c a c c c a b d d d b c d

PAGE 54

54 A B Figure 3 3 . Bermudagrass root length in the pathogenicity test. Each bar is a treatment mean . Means followed by common letters are not different according to range test ( P Error bar represents standard error of each treatment. A) Root le ngth results of Belonolaimus longicaudatus Pythium test. Treatments are listed in Table 3 1 (n = 10 in Repetition s 1 and 2; n = 4 in Repetition 3) . * Root length differe nces among three repetitions were because Repetitions 1 and 2 were conducted in 10 ml pipette tips, while Repetition 3 was conducted in PVC pipes. B) Root length r esults of Meloidogyne graminis Pythium test. Treatments are listed in Table 3 2 (n = 4 in each repetition) . 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ( c m ) ! B4 Pa 4 Pc4 Pm4 U B5 Pa 5 Pc5 Pm5 bc d abc abc ab abc cd a abc cd d b b bc b cd a a e e abc de b cd de ab a cd * 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ( c m ) ! M4 Pa 4 Pc4 Pm4 U M5 Pa 5 Pc5 Pm5 c c b c b b ab a ab bc c a ab bc ab bc ab bc abc abc abc ab c abc bc a abc

PAGE 55

55 A B Figure 3 4 . Effects of Belonolaimus longicaudatus on Pythium arrhenomanes inoculate d bermudagrass . Treatments are listed in Table 3 1. Each bar is a treatment mean . Means followed by common letters are not different according to range test ( P Error bar represents standard error of each treatment. A) Pythium percent infection results . Data of all three repetitions were combined ( P > 0.05) (n=24 ). B) R oot length results. E ach repetition was analyzed separately ( P 0.05) (n = 10 in Repetition s 1 and 2, n = 4 in Repetition 3). * Root length differe n ces among three repetitions were because Repetitions 1 and 2 were conducted in 10 ml pipette tips, while Repetition 3 was conducted in PVC pipes. 0 0.2 0.4 0.6 0.8 1 1.2 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! ! Pa 4 BPa 4 B5 Pa 4 B4 U B5 Pa 5 B4 Pa 5 BPa 5 a a a c c c a b a 100 80 60 40 20 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ! ( c m ) ! Pa 4 BPa 4 B5 Pa 4 B4 U B5 Pa 5 B4 Pa 5 BPa 5 cd d ab ab a ab bc ab bc d c c d c b cd a cd c abc abc c abc bc a abc ab *

PAGE 56

56 A B Figure 3 5 . Effects of Belonolaimus longicaudatus on Pythium catenulatum inoculated bermudagrass. Treatments are listed in Table 3 1. Each bar is a treatment mean (n = 10 in Repetitions 1 and 2; n = 4 in Repetition 3). Means followed by common letters are not different according range test ( P Error bar represents standard error of each treatment. A) Effects of B. longicaudatus on Pythium percent infection. B) Effects of B. longicaudatus on root length of bermudagrass inoculated with P. catenulatum . * Root length differences among three repetitions were because Repetitions 1 and 2 were conducted in 10 ml pipette tips, while Repetition 3 was conducted in PVC pipes. 0 0.2 0.4 0.6 0.8 1 1.2 Repetition 1 Repetition 2 Repetition 3 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! ! Pc4 BPc4 B5 Pc4 B4 U B5 Pc5 B4 Pc5 BPc5 100 80 60 40 20 b bc a c c c bc ab ab b b a b b b b b ab a a a a a a a a a 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ! ( c m ) ! Pc4 BPc4 B5 Pc4 B4 U B5 Pc5 B4 Pc5 BPc5 cd a ab d b cd cd bc a b cd bc ab ab d cd bc a ab ab a a a a a a a a a *

PAGE 57

57 A B Figure 3 6 . Effects of Belonolaimus longicaudatus on Pythium middletonii inoculat ed bermudagrass. Treatments are listed in Table 3 1. Each bar is a treatment mean (n = 10 in Repetitions 1 and 2; n = 4 in Repetition 3). Means followed range test ( P Error bar repr esents standard error of each treatment. A) Effects of B. longicaudatus on Pythium percent infection. B) Effects of B. longicaudatus on root length of bermu dagrass inoculated with P. middletonii . * Root length differences among three repetitions were because Repetitions 1 and 2 were conducted in 10 ml pipette tips, while Repetition 3 was conducted in PVC pipes. 0 0.2 0.4 0.6 0.8 1 1.2 Repetition 1 Repetition 2 Repetition 3 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! ! Pm4 BPm4 B5 Pm4 B4 U B5 Pm5 B4 Pm5 BPm5 a a a a a a a a a a a a a a a a a a b b a b b b b b a 100 80 60 40 20 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ! ( c m ) ! Pm4 BPm4 B5 Pm4 B4 U B5 Pm5 B4 Pm5 BPm5 b cd bc ab cd ab b cd b cd a d b b a c bc b a b a a a a a a a a a a *

PAGE 58

58 A B Figure 3 7 . Effects of Meloidogyne graminis on Pythium arrhenomanes inoculated be rmudagrass. Treatments are listed in Table 3 2. Each bar is a treatment mean . Means followed by common letters are not different according to range test ( P Error bar represents standard error of each treatment. A) Effects of M. graminis on Pythium percent infection . Data of all three repetitions were combined ( P > 0.05) (n=12). B) Effects of M. graminis on root length of bermu dagrass inoculated with P. arrhenomanes . Each repetition was analyzed separately ( P 0.05) (n = 4). 0 0.2 0.4 0.6 0.8 1 1.2 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! Pa 4 MPa 4 M5 Pa 4 M4 U M5 Pa 5 M4 Pa 5 MPa 5 ab a bc d d d c abc abc 100 80 60 40 20 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ( c m ) ! Pa 4 MPa 4 M5 Pa 4 M4 U M5 Pa 5 M4 Pa 5 MPa 5 c ab a bc a a a a a a a a a a a a a a a a a a a a a a a

PAGE 59

59 A B Figure 3 8 . Effects of Meloidogyne graminis on Pythium catenulatum inoculate d bermudagrass. Treatments are listed in Table 3 2. Each bar is a treatment mean (n=4) . Means followed by common letters are not different according to range test ( P Error bar represents standard error of each treatment. A) Effects of M. graminis on Pythium percent infection. B) Effects of M. graminis on root length of bermudagrass inoculated with P. catenulatum . 0 0.2 0.4 0.6 0.8 1 1.2 Repetition 1 Repetition 2 Repetition 3 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! Pc4 MPc4 M5 Pc4 M4 U M5 Pc5 M4 Pc5 MPc5 100 80 60 40 20 ab cd bc d d d a a a a b b b b b b b ab a b c c c c b c a 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ( c m ) ! Pc4 MPc4 M5 Pc4 M4 U M5 Pc5 M4 Pc5 MPc5 b b ab c b b a b ab ab cd ab d cd b cd b cd a abc bc d ab bc cd bc ab a ab

PAGE 60

60 A B Figure 3 9 . Effects of Meloido gyne graminis on Pythium middletonii inoculate d bermudagrass. Treatments are listed in Table 3 2. Each bar is a treatment mean (n=4) . Means followed by common letters are not different according to range test ( P Error bar represents standard error of each treatment. A) Effects of M. graminis on Pythium percent infection. Data of all three repetitions were combined ( P > 0.05) (n=12). B) Effects of M. graminis on root length of bermu dagrass inoculated with P. middle tonii . Each repetition was analyzed separately ( P 0.05) (n = 4) 0 0.2 0.4 0.6 0.8 1 1.2 4 . 2 3 ' ) ( p e r c e n t i n f e c t i o n % ! Pm4 MPm4 M5 Pm4 M4 U M5 Pm5 M4 Pm5 MPm5 100 80 60 40 20 a a a a a a a a a 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Repetition 1 Repetition 2 Repetition 3 R o o t l e n g t h ( c m ) ! Pm4 MPm4 M5 Pm4 M4 U M5 Pm5 M4 Pm5 MPm5 d bc a d abc bc ab c abc a a a a a a a a a a a a a a a a a a

PAGE 61

61 CHAPTER 4 PATHOGEN ATTRACTION TEST Introduction The development of a plant disease includes three components (host plant, pathogen, and favorable environment) and seven stages (inoculation, penetration, infection, colonization, reproduction, dissemination, and survival). Agrios (2005) indicated that ino culation (introducing pathogens to host plants) was very important to the occurrence of plant disease. Most pathogens are carried to host plants by wind, water and vectors . Plant parasitic nematodes and zoospores may be attracted to host plants by the subs tances released from plant roots. Meloidogyne hapla and M. javanica juveniles were attracted to tomato root tips , and the number of attracted nematodes Pythium aphanidermatu m were attracted to roots of many crops including alfalfa, bean, tomato, etc. (Royle and Hickman, 1964); zoospores of P. dissotocum were attracted to cotton root cap cells (Goldberg et al., 1989). In a disease complex, co occurring pathogens may affect each other antagonistically and/or synergistically. In the Ascochyta blight complex on pea, the co occurring pathogens Mycosphaerella pinodes and Phoma medicaginis var . pinodella showed antagonistic effects on disease development when presented together on host plants; synergistic effects on damage were observed when one pathogen was inoculated ahead of the other pathogen (Le May et al., 2009). In a previous bermudagrass root rot c omplex disease study, both Belonolaimus longicaudatus and M. graminis had antagonistic effects on infection by Pythium arrhenomanes ; and

PAGE 62

62 bermudagrass root infection by P. catenulatum was increased by B. longicaudatus but reduced by M. graminis . Greenhouse and lab tests were conducted to study the effects of nematode or Pythium spp. infected roots on the movement and infection of the other pathogen. Our hypotheses were that: a) bermudagrass roots inoculated with M. graminis or one of the three Pyt hium isolates ( P. arrhenomanes , P. catenulatum and P. middletonii ) would be less attract ive to the other pathogen , b) B. longicaudatus or P. arrhenomanes ino culated roots would repel or reduce d infection by the other pathogen , and c) that B. longicaudatus , or one of the two Pythium isolates ( P. catenulatum and P. middletonii ) inoculated roots would attract or increase the infection by the other pathogen. Materials and Methods Inocula P reparation T hree Pythium isolates ( Pythium arrhenomanes , P. catenulatum , and P. middletonii ) were used as Pythium inocula. Each Pythium inoculum was prepared as described in Chapter 3. M ycelia plugs were incubated with sterilized 0.5 cm St. Augustinegrass ( Stenotaphrum secundatum ) leave blades in sterilized deionized water under continuous fluorescent light at 24¡C for three days. Inoculation was perf ormed by burying inoculum ( Pythium colonized grass blades) at a 0.5 cm depth. Nematode inocula, B. longicaudatus and M. graminis , were extracted using a modified mist chamber me thod (unpublished method developed by Dr. William T. Crow) for 72 hours. Belonolaimus longicaudatus were cultured on St. Augustinegrass and M. graminis were cultured on bermudagrass.

PAGE 63

63 Greenhouse Attraction T est U shape PVC containers assembled by connectin g three 4 cm diameter 15 cm length PVC pipes through two 90 degree and 5 cm diameter PVC elbows were used in this greenhouse trial. A hole was made in the middle of each container bridge for inoculation (Figure 4 r node were planted in seed starting trays filled with autoclaved USGA specification sand (USGA green section staff, 2018) for two weeks, then transplanted in to the U shape PVC containers filled with 1000 cm 3 sterilized USGA specification sand. Two bermuda grass sprigs with similar root length and am ount were planted in each 15 cm height PVC arm of each container. Grass sprigs were maintained in greenhouse by irrigating with 1.5 cm of water three times daily and fertilizing with one ml (for pipette tip) or 50 ml (for PVC pipe) Miracle Gro Water Soluble All Purpose Plant Food (Scotts Miracle Gro Products, Inc., Marysville, OH) once biweekly at 5 g fertilizer /L solution . All containers were separated into four groups, each with 15 containers. In the first grou p, two weeks after transplanting, one PVC arm in each container was inoculated with Pythium by burying four Pythium colonized grass blades of one of the three Pythium spp. at a 0.5 cm depth . B elonolaimus longicaudatus were inoculated one week later into th e container bridge by pipetting 2 ml of nematode suspension contain ing 25 nematodes into the hole in the bridge center. For the second group, 2 ml of B. longicaudatus suspension containing 25 nematodes were pipetted into the top portion of one PVC arm and four Pythium colonized grass blades were buried into the hole in the middle bridge at 0.5 cm depth one week later. In the third group, two weeks after transplanting, one PVC arm in each container was inoculated with one of the three Pythium spp. as describ ed for group one and 2 ml of M. graminis suspension containing

PAGE 64

64 500 J2 were pipetted into the hole in the bridge center one week later . For the forth group, 2 ml of M. graminis suspension containing 500 J2 were pipetted into the top portion of one PVC arm and Pythium was inoculated into the bridge as describe d for group two one week later. In each container, the PVC arm inoculated with neither Pythium inoculum nor nematode was the control. This test was repe ated twice in greenhouse. All containers were arranged in a completely randomized design with 5 replications in each repetition of the B. longicaudatus trial, and either 5 replications or 10 replications for the two repetitions of the M. graminis trial. Si x weeks after bermudagrass sprigging, U shape PVC containers were dis as sembled into three parts including two arms each contained one 4 cm diameter 15 cm length PVC pipe and one five cm diameter 90 degree PVC elbo w, and one bridge which was 4 cm diameter 1 5 cm length PVC pipe. Results were collected from the PVC arms. In groups one and two, B. longicaudatus were extracted from soil in each container arm using a centrifugal flotation technique (Jenkins, 1964) using a 38 ., MA), and nematodes were identified into genus and counted using an Olympus CK30 inverted microscope at 20! magnification . T he bermudagrass roots in each arm were washed and Pythium percent infection was recorded as described in Chapter 3. In groups thr ee and four, M. graminis were extracted from soil in each container arm using the same method as B. longicaudatus . In Repetition 1, half of the roots in each arm were processed using a modification of an acid fuchsine staining method (Byrd et al., 1983) followed by counting nematode s and number of Pythium zoospores in roots. Roots with no zoospore attachment were 3);

PAGE 65

65 the other half roots were processed to measure Pythium perce nt infection. In Repetition 2, the modified acid fuchsine st aining method was applied to entire root systems, and only nematode numbers and zoospore observation results were recorded. Lab Attraction T est planted into each 5 ml pipette tip (Fisher Scientific International, In c., Hampton, NH) filled with 6 cm 3 autoclaved USGA specification sand (USGA green section staff, 2018) (Figure 4 2). The bermudagrass sprigs were maintained in greenhouse by irrigating with 1.5 cm of water three times daily and fertilizing with 1 ml (for pipette tip) or 50 ml (for PVC pipe) Miracle Gro Water Soluble All Purpose Plant Food (Scotts Miracle Gro Products, Inc., Marysville, OH) once biweekly at 5 g fertilizer /L solution . Fou r weeks after bermudagrass sprigging, 15 B. longicaudatus , 30 M. graminis or one of the three Pythium species inocula (two Pythium colonized grass blades for each species) were inoculated separately in to the pipette tips planted with grass. Each tr eatment pipette tip had an un inoculated pipette tip to compare with. This test had 10 replications of each treatment and was repeated three times. Bermudagrass roots in each pipette tip were collected two week after inoculation and surface sterilized by 0.6% sodiu m hypochlorite method mentioned in Chapter 2. Pythium selective PART media were used to study the effects of plant parasitic nematode infested bermudagrass roots on the mycelia growth of each Pythium spp. Surface sterilized B. longicaudatus or M. graminis infested roots and uninoculated roots were placed on two ends of each 100 diameter petri dish (Fisher Scientific International, Inc., Hampton, NH) contained PART media; one 3 x 3 mm mycelia plug of each Pythium spp. was placed in the middle of each petri d ish. All petri dishes were

PAGE 66

66 incubated at 24 ¡C for three to five days. Mycelia growth results of each Pythium spp. on each nematode treated and untreated roots were recorded. Roots that stopped owth of mycelia were 4). Pluronic F 127 gel was used to study the effects of each Pythium spp. infested bermudagrass roots on the movement of B. longicaudatus or M. graminis . To make 23% 100 ml gel, 23 g Pluronic F 127 powder (Sig ma Aldrich Corporation , St. Louis, MO) was add ed to 60 ml cold, deionized water, and stirred to dissolve at 6 ¡C for 24 hours; then cold deionized water was added to make the total solution 100 ml and continuously stirred at 6 ¡C for another hour to make s olution was well mixed (Wang et al., 2009). The dissolved gel was stored at 10 ¡C. Five ml of 23% Pluronic gel containing 20 B. longicaudatus or 50 M. graminis J2 , fresh extracted by a modified mist chamber method (unpublished method developed by Dr. Willi am T. Crow) , was poured into 5 cm diameter petri dishes (Fisher Scientific International, Inc., Hampton, NH) at 10 ¡C. Surface sterilized Pythium inoculated and non inoculated roots were placed on two ends of petri dish, then the petri dish was transferred to 24 ¡C for the gel to solidify. The number of plant parasitic nematodes around the root surface (0.5 cm) was counted 24 hours later using an Olympus CK30 inverted microscope. Data A nalyses All statistical analyses were performed using SAS ¨ 9.4 (SAS Institute Inc., Cary, NC) . T test s were conducted to compare each inoculated treatment with the uninoculated control .

PAGE 67

67 Results Pythium Inoculated Roots N ematode In the greenhouse attraction test, only P. middletonii inoculated roots had more ( P = 0.07) B. longicaudatus recovered than uninoculated roots in Repetition 1 (Table 4 1). In the lab attraction test, t he number of B. longicaudatus was higher around P. middletonii ( P = 0.002 in Repetition 1) or P. arrhenomanes ( P = 0.04 in Repetition 2 a nd P = 0.03 in Repetition 3) infected bermudagrass roots than from a round roots of the uninoculated (Table 4 2); r oots inoculated with P. catenulatum ( P < 0.0001 in Repetition1 and P = 0.01 in Repetition 2) or P. arrhenomanes ( P = 0.09 in Repetition 1) wer e less attractive to B. longicaudatus than uninoculated roots in Repetitions 1 ( P = 0.001) and 2 ( P = 0.01) of the l ab attraction test (Table 4 2). M eloidogyne graminis was more attracted ( P = 0.08) by bermudagrass roots inoculated with P. arrhenomanes in Repetition 1 in the greenhouse attraction test (Table 4 3). In the lab attraction test, bermudagrass roots inoculated with P. middletonii or P. arrhenomanes were less attractive to M. graminis compared with inoculated roots, Repetition 2 for P. middletonii ( P = 0. 08 ) and Repetition 3 for P. arrhenomanes ( P = 0.002 ) (Table 4 4) . Meloidogyne graminis had no preferenc e for roots inoculated with P. catenulatum in an y of the tests (Table s 4 3, 4 4) . Nematode Infested R oots Pythium In the greenhouse attraction test, no Pythium infection was observed on B. longicaudatus infested or non infested bermudagrass roots (Table 4 5); there was no Pythium percent infection difference between M. graminis inoculated and uninoculated bermudagrass roots (Table 4 8). More P. c atenulatum zoospores were observed on M.

PAGE 68

68 graminis infested roots in Repetition 1 ( P = 0. 07 ) than around uninoculated roots (Table 4 7). In the lab attraction test, mycelia contact from P. arrhenomanes ( P = 0. 04 ) was less for roots inoculated with B. longicaudatus than for uninoculated roots (Table 4 6). Meloidogyne graminis infested roots had less ( P = 0. 04 ) contact from P. catenulatum than uninoculated roots in Repetition 2 (Table 4 9). Discussion For the greenhouse tests, the number of nematodes rec overed, percent Pythium infection, and the zoospore attachments were all very low and, therefore, the results from those trials were inconclusive. Similarly, in the lab attraction test the numbers of nematodes interacting with roots were low and the resul ts were highly variable among repetitions. Therefore, while some significant differences occurred it is difficult to draw any conclusions from that data. Bermudagrass roots infested with either B. longicaudatus or M. graminis reduced mycelia growth of thr ee Pythium spp. , although inconsistently. The suppression on mycelia growth might be cause d by nematodes induc ing bermudagrass root s to release defen c e chemicals. Anti fungal chemicals were produced by Tylenchulus semipenetrans to inhibit the mycelial growth of Phytophthora nicotianae and Fusarium solani and protect their feeding sites in citrus roots (EI Borai et al., 2002a). Bais et al. (2002) observed rosmarinic acid (RA) in sweet basil root exudate when plant roots were elic ited using Phytophthora cinnamon and Pythium ultimum . RA is a caffeic acid ester demonstrated has potential antimicrobial ability. Naphthoquinones was present in the root exudates of gromwell, which had biological activity against soil borne fungi and bact eria ( Brigham et al, 1999 ). In order to confirm the presence of defence chemicals in

PAGE 69

69 the root exudates, a metabolomics tests on pathogen infested bermudagrass root exudates should be conducted. Based on these results, the effects of nematode or Pythium ino culated roots on the movement and infection of the other pathogen were not fully answered. More replications and larger nematode population density should be involved if experiments will be conducted again.

PAGE 70

70 Table 4 1. Results from a greenhouse attr action test evaluating the number of Belonolaimus longicaudatus around Pythium inoculated (I) and un inoculat ed (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 I U I U P . middletonii 0 .6 ± 0 . 5 * 0 .0 ± 0. 0 0 .0 ± 0 .0 0 .0 ± 0 .0 P. catenulatum 0 .0 ± 0 .0 0 .2 ± 0 . 4 0 .0 ± 0 .0 0 .0 ± 0 .0 P. arrhenomanes 0 .0 ± 0.0 0 .0 ± 0 .0 0 .0 ± 0 .0 0 .0 ± 0 .0 Mean with * is different from uninoculated control according to t test . Table 4 2 . Results from a lab attraction test evaluating the number of Belonolaimus longicaudatus around Pythium inoculated (I) and un inoculated (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 Repetition 3 I U I U I U P . middletonii 1 .0 ± 0.7 *** 0.1 ± 0.3 0.9 ± 0.7 0.4 ± 0.7 2.2 ± 1.5 2 .0 ± 1.3 P. catenulatum 0.1 ± 0.3 *** 1.1 ± 0.6 0.2 ± 0.4 ** 1.3 ± 1.1 3 .0 ± 1.9 3.5 ± 2.7 P. arrhenomanes 0 .0 ± 0 .0 * 1.1 ± 1.9 0.9 ± 0.9 ** 0.2 ± 0.4 3.5 ± 2.3 * * 1.5 ± 1.4 Means with *, **, *** are different from uninoculated control according to t test , , 0.05, 0.01, respectively .

PAGE 71

71 Table 4 3. Results from a greenhouse attraction test evaluating the number of Meloidogyne graminis around Pythium inoculated (I) and un inoculated (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 I U I U P . middletonii 1.4 ± 1.7 0.4 ± 0.9 1.4 ± 1.7 0.3 ± 0.6 P. catenulatum 2.8 ± 4.1 0.8 ± 1.8 2.0 ± 2.9 3.3 ± 3.8 P. arrhenomanes 3.6 ± 2.6 * 0.8 ± 1.8 0.1 ± 0.3 0.3 ± 0.7 Mean with * is different from uninoculated control according to t test , P . Table 4 4 . Results from a lab attraction test evaluating the number of Meloidogyne graminis around Pythium inoculated (I) and un inoculated (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 Repetition 3 I U I U I U P . middletonii 5.4 ± 6.6 5.2 ± 2.4 0.5 ± 1.0 * 1.3 ± 0.9 1.3 ± 0.9 2.1 ± 1.7 P. catenulatum 4 .0 ± 2.9 3.8 ± 3.5 0.1 ± 0.3 0.5 ± 0.7 2 .0 ± 2.1 2.3 ± 2.2 P. arrhenomanes 4.4 ± 5.3 6.3 ± 7.3 0.3 ± 0.5 0.2 ± 0.6 1.2 ± 0.9 *** 3.3 ± 1.6 Means with * , *** are different from uninoculated control according to t test , P 0.01, respectively .

PAGE 72

72 Table 4 5 . Results from a greenhouse attraction test evaluating the Pythium percent infection (%) on Belonolaimus longicaudatus i noculated (I) and un i noculat ed (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 I U I U P . middletonii 0 ± 0 0 ± 0 0 ± 0 0 ± 0 P. catenulatum 0 ± 0 0 ± 0 0 ± 0 0 ± 0 P. arrhenomanes 0 ± 0 0 ± 0 0 ± 0 0 ± 0 No significan t differences between inoculated treatment and uninoculated control was observed ( P > 0.1) according to t test . Table 4 6 . Results from a lab attraction test evaluating Pythium mycelia growth on Belonolaimus longicaudatus inoculated (I) and uninoculated (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 I U I U P . middletonii 0.5 ± 0.5 0.8 ± 0.4 1 .0 ± 0 .0 1 .0 ± 0 .0 P. catenulatum 0.8 ± 0.4 1 .0 ± 0 .0 1 .0 ± 0 .0 1 .0 ± 0 .0 P. arrhenomanes 0.6 ± 0.5 ** 1 .0 ± 0 .0 1 .0 ± 0 .0 1 .0 ± 0 .0 Mean with ** is different from uninoculated control according to t test , P 0.05 .

PAGE 73

73 Table 4 7 . Results from a greenhouse attraction test evaluating Pythium zoo spore observation on Meloidogyne graminis inoculated (I) and uninoculat ed (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 I U I U P . middletonii 0 .8 ± 0.4 0 .4 ± 0.5 0 .8 ± 0.4 1 .0 ± 0 .0 P. catenulatum 0 .8 ± 0.4 * 0 .2 ± 0.4 1 .0 ± 0 .0 0 .9 ± 0.3 P. arrhenomanes 0 .8 ± 0.4 0 .4 ± 0.5 0 .8 ± 0.4 0 .8 ± 0.4 Mean with * is different from uninoculated control according to t test , P . Table 4 8 . Results from a greenhouse attraction test evaluating the Pythium percent infection (%) on Meloidogyne graminis inoculated (I ) and uninoculat ed (U) bermudagrass roots . Treatment Repetition 1 I U P . middletonii 2 0 ± 27 2 0 ± 27 P. catenulatum 5 0 ± 4 0 15 ± 1 4 P. arrhenomanes 55 ± 37 75 ± 35 No significant differences between inoculated treatment and uninoculated control was observed ( P > 0.1) according to t test . Table 4 9. Results from a lab attraction test evaluating Pythium mycelia growth on Meloidogyne graminis inoculated (I) and uninoculat ed (U) bermudagrass roots . Treatment Repetition 1 Repetition 2 I U I U P . middletonii 0.7 ± 0.5 0.8 ± 0.4 0.5 ± 0.5 0.7 ± 0. 5 P. catenulatum 1 .0 ± 0 .0 1 .0 ± 0 .0 0.6 ± 0.5 ** 1 .0 ± 0 .0 P. arrhenomanes 1 .0 ± 0 .0 1 .0 ± 0 .0 0.8 ± 0.4 1 .0 ± 0 .0 Mean with ** is different from uninoculated control according to LSMeans, P .

PAGE 74

74 Figure 4 1. U shap e PVC containers applied in the greenhouse attraction test. Each container was assembled by connecting three four cm diameter 15 cm length PVC pipes through two 90 degree five cm diameter PVC elbows . The left elbow was inoculated with one pathogen (nematode or Pythium spp.) as treat ment; the right elbow was inoculated with nothing as control. One week after treatment inoculation, the other pathogen ( Pythium spp. or nematode) was inoculated to the hole in the middle of the container bridge . Figure 4 2 . Bemudagrass sprigs planted in five ml pipette tips in the lab attraction test.

PAGE 75

75 A B Figure 4 3. One example of b ermudagrass roots with and without Pythium zoospore attachment. Zoospores indicated by red arrows. A) Roots with no Pythium Pythium zoospore .

PAGE 76

76 Figure 4 4 . One example of nematode infected bermudagrass roots stop ping Pythium mycelia growth. Roots stopped mycelia growth (on the right s ide of PART medium the left side of P ART medium ) were reco . bermudagrass roots inoculated with Belonolaimus longicaudatus uninoculated roots, and P. middletonii mycelia plug is placed in the middle.

PAGE 77

77 CHAPTER 5 ROOT EXUDATE METABOLOMIC TEST Introduction Plant roots diffuse many compounds that impact interactions in rhizosphere, including root root, root insect, and root microbe interactions. These interactions can be classified as positive, negative, or neutral associations (Bais et al., 2006). Hiltner fi rst organisms in soil. Plant roots diffuse nutrients in exudates that attract many organisms in soil including soil borne pathogens, nematodes, insects, etc. The chemical attraction studies have been conducted on many organisms including oomycete zoospores and plant parasitic nematodes (Royle and Hickman, 1963; Goldberg et al., 1989; Zho u and Paulitz, 1993; Nicol et al., 2003; Wang et al., 2009; ). Plant root exudates can also contain compounds such as rosmarinic acid, salicylic acid, etc. that have antagonistic effects on soil organisms (Bais et al., 2002; Branch et al., 2004). Our specific research interest was nematode Pythium root interactions. Root exudates provide carbon sources that attract plant parasitic nematode s and Pythium spp. to the rhizosphere . However, they may also contain adverse factors to Pythium spp. and plant parasitic nematodes. Antagonistic effects were observed in our previous experiments. In this experiment, compounds in root exudates of bermudagrass inoculated with and without different pathogens were identified and compared . My hypothesis was that fungicidal or nematicidal compounds would be detected in nematode or Pythium inoculated bermudagrass root exudates.

PAGE 78

78 Materials and Methods Root Exudates C ollection 4 cm diame ter ConeTainer s cm 3 autoclaved USGA specification sand (USGA green section staff, 2018). Two weeks after grass sprigging all ConeTainers were divided into six groups with twelve ConeTainers in each group . Five groups were inoculated with 50 Belonolaimus longicaudatus , 130 Meloidogyne graminis , four Pythium arrhenomanes colonized St. Augustinegrass blades, four P. catenulatum colonized St. Augustinegrass blades, or four P. middletonii colonized St. Augustinegrass blades , separately. The last group was a n uninoculated control. Plant parasitic nematode and Pythium inocula were prepared with the methods described in Chapter 3. Bermudagrass sprigs were maintained in greenhouse by irrigating with 1.5 cm o f water three times daily and fertilizing with one ml (for pipette tip) or 50 ml (for PVC pipe) Miracle Gro Water Soluble All Purpose Plant Food (Scotts Miracle Gro Products, Inc., Marysville, OH) once every two weeks at 5 g fertilizer /L solution . Six week after sprigging, all ConeTainers were taken down for root exudates collection. Containers of each treatment were subdivided into four sets with three ConeTainers in each set. All bermudagrass roots in each set were washed in running deionized water follow ed by rinsing with sterili zed Milli Q water for 30 sec , then transferred to 120 ml sterilized glass flasks containing 100 ml of sterilized Milli Q water for 24 hours at 24 ¡C. Milli Q water containing exudates was immediately filter sterilized using 0.22 m syringe filters ( Fisher Scientific International, Inc., Hampton, NH ). Thirty five ml of root exudates from each treatment were immediately frozen using liquid

PAGE 79

79 nitrogen, then lyophilized using a Labconco FreeZone Bulk Tray Dryer (Labconco Corporation, Kan Root Exudates A nalysis Six root exudates samples (one in each treatment and the control) were sent to the UF/SECIM Cores for a LC MS Global metabolomics test on an UPLC HRMS (Model: Thermo Ultimate 3000 UPLC and Thermo Q Exactive mass spectrometer) (Khan et al., 2018). MZmine 2.34 software was used to analyze the raw data collected from the UPLC HRMS. After removing additives and complexes from the data set, data from positive and negative ion modes were blast through mzCloud TM (an advanced mass spectral database). Results The metabolite compound blast results of the six root exudate samples are listed in Table 5 1. There were 143 targeted metabolites observed in all six samples; 53 metabolites were found through negative ion mode, and 90 metabolites were obtained through positive ion mode. Among all compounds analyzed, isoleukotoxin, benzoic acid, isorhamnetin, acetamide, trans ci nnamic acid, adenine, D alanine methyl ester, L alanine methyl ester, L(+) 2 aminobutyric acid, melamine, methionine, methyl picolinate, spermidine, and gamma aminobutyric acid (GABA) were only present in the pathogen non inoculated bermudagras s (control U ). Metabolites 1,5 anhydro D glucitol, D (+) fucose, L( ) fucose, benzene sulfonic acid , and 6,7 dihydro 1H [1,4]dioxino[2',3' 4,5]benzo[d]imidazole 2 thiol were only observed in bermudagrass inoculated with B. longicaudatus (treatment S ); metabolite

PAGE 80

80 2,5 d i tert butylhydroquinone was only found in bermudagrass inoculated wit h either nematode, (treatments B and M ) . Azelaic ac id was presented in treatments B and M , and also in bermudagrass inoculated with P. middletonii (Pm ). The metabolite benzamide was only observed in bermudagrass inoculated with P. arrhenomanes (treatment Pa ) . Acetic aci d was only found in treatments Pa and Pm . Citr inin was present in treatments Pa, M, B , and P. catenulatum inoc ulated bermudagrass (treatment Pc ) . Sulcatol was found in all test treatments, but not in the unin oculated control . The metabolites benzeneoctanoic acid, citric acid, isocitric acid, 4 Methyl N,N dimethylcathinone, and DEET were observed in treatments P c, Pm and control U . Discussion Benzene sulfoni c acid was only present in B. longicaudatus infested bermudagrass. Benzoic acid, a plant phenolic compound generated through the phenylpropanoid pathway, is known to inhibit fungal growth. Acidic conditions are more favor to the inhibitory effects of benzo ic acid on fungal growth (Matsuzaki et al., 2008). Propolis has an inhibitory effect on the hyphal growth of Pythium insidiusum , and benzoic acid is one of the main compounds in propolis (AraÂœjo et al., 2016). Because benzene sulfonic acid is more acidic t han benzoic acid , it may inhibit Pythium hyphal growth. This may be one reason for observations in Chapter 3 that P. arrhenomanes infection on bermudagrass roots was reduced when B. longicaudatus was inoculated one week ahead of P. arrhenomanes , and Chapte r 4 that B. longicaudatus infested bermudagrass roots reduced mycelia growth of all three Pythium spp. to some degree . Azelaic acid was found in exudates from bermudagrass inoculated with B. longicaudatus , M. graminis , and P. middletonii . Azelaic acid together with azelaic acid

PAGE 81

81 induced 1 (AZI1) gene are involved in plant systemic immunity (Jung et al., 2009). AZI1 gene is induced by azelaic acid when the plant is under biotic and abiotic stress . F or example , either infection by the nemato de Heterodera schachtii or drought results in the accumulation of salicylic acid, a defense signal upon infection (Atkinson et al., 2013) . Azelaic acid may be another reason for the decrease of P. arrhenomanes percent infection on B. longicaudatus infested bermudagrass roots and Pythium mycelia growth reduction by B. longicaudatus or M. graminis infested bermudagrass roots. The presence of benzene sulfonic acid in B. longicaudatus infested bermudagrass root exudates and azelaic acid in the root exudates of bermudagrass infested with B. longicaudatus and M. graminis might account for the antagonistic effects on Pythium infection and mycelial growth. Benzamide was only observed in P. arrhenomanes inoculated bermudagrass inoculated with P. arrhenomanes . Benzami de has been reported have nematicidal and egg hatch inhibiting effects on M. incognita (Hackney and Dickerson , 1975; Goswami and Vijayalakshmi , 1986; Adegbite and Adesiyan , 2005; Asif et al., 2014). The metabolite 2 ({2 [(1 benzylpiperidin 4 yl)amino ] 2 oxoethyl}thio) acetic acid was present only in exudates from bermudagrass inoculated with P. arrhenomanes or P. middletonii . Reports in literature indicat e that acetic acid produced by Purporeum lilacinum ( a nematophagous fungus) and Trichoderma longib rachiatum had nematotoxic effects on juveniles of Meloidogyne spp. Nematode juveniles were paralyzed in acetic acid with concentrations up to dilution 1/800 w/v; and nematode juvenile immobilization required time was from five minutes in 1 M/l concentratio n to 24 hours in dilution 1/800 w/v (Djian Caporalino et al., 1991). Seo and Kim (2014) observed complete mortality of

PAGE 82

82 M. incognita juveniles when exposed to acetic acid concentrat ions of 1.0%, 0.5%, 0.2% and 0.1%. As a deviant of acetic acid, 2 ({2 [(1 be nzylpiperidin 4 yl) amino] 2 oxoethyl}thio) acetic acid may also have nematicidal effects on M. graminis juveniles. The c ompound 2 ({2 [(1 benzylpiperidin 4 yl) amino] 2 oxoethyl}thio) acetic acid may be the reason for fewer M. graminis observations around bermudagrass roots inoculated with P. arrhenomanes or P. middletonii when compared to pathogen non inoculated control. The hypothesis of this experiment was not fully tested. To make results solid, more replications of treatment and control sh ould be invo lved in future studies . The fungicidal or nematicide effects of compound observed in root exudates are reported in literature. To confirm the pesticidal effects, compounds will be tested directly on reproduction, mobility and mortality of B. longicaudatus and M. graminis , and mycelial growth and infection ability of the three Pythium isolates.

PAGE 83

83 Table 5 1. Metabolites observed in root exudates from six bermudagrasses samples. Samples are : bermudagrass inoculated with Pythium arrhenomanes (Pa ) , P. catenulatum (Pc ) , P. middletonii (Pm ) , Belonolaimus longicaudatus (B ) , or Meloidogyne gramnins (M ), and pathogen non inoculated (U) bermudagrass. + M eans metabolite presented in sample; means metabolite was absent in sample . # Polarity Metabolite name Pa Pc Pm M B U 1 Negative Isoleukotoxin + 2 Negative B enzoic acid + 3 Negative Isorhamnetin + 4 Negative A cetamide + 5 Negative trans C innamic acid + 6 Negative 1,5 Anhydro D glucitol + 7 Negative D (+) Fucose + 8 Negative L( ) Fucose + 9 Negative Benzene sulfonic acid + 10 Negative 2,5 di tert Butylhydroquinone + + 11 Negative 2 Butoxyacetic acid + 12 Negative 2 Hydroxy 2 methylbutyric acid + 13 Negative 2 Hydroxycaproic acid + 14 Negative 2 Hydroxyisovaleric acid + 15 Negative 2 Hydroxyphenylalanine + 16 Negative 2 Hydroxyvaleric acid + 17 Negative 2 Methyl 3 hydroxybutyric acid + 18 Negative 2,3 Dihydroxybenzoic acid + 19 Negative 2,4 Dihydroxybenzoic acid + 20 Negative 3 (4 Hydroxyphenyl) propionic acid + 21 Negative 3 Amino 3 (4 hydroxyphenyl) propanoic acid + 22 Negative 3 Hydroxy 3 methylbutanoic acid + 23 Negative 3 Hydroxyvaleric acid + 24 Negative 3 Methyladipic acid + 25 Negative 3 Phenyllactic acid + 26 Negative 3,5 Dihydroxybenzoic acid +

PAGE 84

84 Table 5 1 . Continued . # Polarity Metabolite name Pa Pc Pm M B U 27 Negative 6 Hydroxycaproic acid + 28 Negative D(+) Phenyllactic acid + 29 Negative Gentisic acid + 30 Negative L ( ) 3 Phenyllactic acid + 31 Negative L Tyrosine + 32 Negative Pimelic acid + 33 Negative Protocatechuic acid + 34 Negative Quercetin + 35 Negative Suberic acid + 36 Negative UDP N acetylglucosamine + 37 Negative Uracil + 38 Negative Uric acid + 39 Negative 15 octadecenoic acid + + 40 Negative 2 Methylglutaric acid + + 41 Negative 2,2 Dimethylsuccinic acid + + 42 Negative 3 Methylglutaric acid + + 43 Negative 4 Oxoproline + + 44 Negative Adipic acid + + 45 Negative L Threonic acid 1,4 lactone + + 46 Negative Methylmalonic acid + + 47 Negative Succinic acid + + 48 Negative Xanthine + + 49 Negative Azelaic acid + + + 50 Negative Benzeneoctanoic acid + + + 51 Negative Citric acid + + + 52 Negative Isocitric acid + + + 53 Negative Naringenin + + + + 54 Positive Adenine + 55 Positive D Alanine methyl ester +

PAGE 85

85 Table 5 1 . Continued . # Polarity Metabolite name Pa Pc Pm M B U 56 Positive L Alanine methyl ester + 57 Positive L(+) 2 Aminobutyric acid + 58 Positive Melamine + 59 Positive Methionine + 60 Positive Methyl picolinate + 61 Positive Spermidine + 62 Positive Aminobutyric acid (GABA) + 63 Positive 6,7 Dihydro 1H [1,4]dioxino[2',3' 4,5]benzo[d]imidazole 2 thiol + 64 Positive 1H Imidazole 4 carboxylic acid + 65 Positive 2 (Methylamino) isobutyric acid + 66 Positive 2 Aminoadipic acid + 67 Positive 2 Aminonicotinic acid + 68 Positive 4 Aminonicotinic acid + 69 Positive 5 Aminonicotinic acid + 70 Positive 6 Aminonicotinic acid + 71 Positive 7 Oxobenz[de]anthracene + 72 Positive Acetanilide + 73 Positive D (+) Pyroglutamic Acid + 74 Positive Guanine + 75 Positive Kanosamine + 76 Positive L 2 Aminoadipic acid + 77 Positive L Pyroglutamic acid + 78 Positive L Valine + 79 Positive Maleic hydrazide + 80 Positive Methionine + 81 Positive Nicotinamide 1 oxide + 82 Positive Norepinephrine + 83 Positive Pyridoxine + 84 Positive Uracil +

PAGE 86

86 Table 5 1 . Continued . # Polarity Metabolite name Pa Pc Pm M B U 85 Positive Urocanic acid + 86 Positive 2 Hydroxyphenylalanine + + 87 Positive 2 Pyridylacetic acid + + 88 Positive 2,2,6,6 Tetramethyl 1 piperidinol (TEMPO) + + 89 Positive 2,2,6,6 Tetramethyl 4 piperidinol + + 90 Positive 3 Pyridylacetic acid + + 91 Positive 4 Aminobenzoic acid + + 92 Positive 4 Pyridineacetic acid + + 93 Positive 6 Aminocaproic acid + + 94 Positive Allopurinol + + 95 Positive Anthranilic acid + + 96 Positive D Carnitine + + 97 Positive DL Carnitine + + 98 Positive Hexadecanamide + + 99 Positive Hypoxanthine + + 100 Positive Isoleucine + + 101 Positive L ( ) Methionine + + 102 Positive L Glutamic acid + + 103 Positive L Isoleucine + + 104 Positive L Norleucine + + 105 Positive L Tyrosine + + 106 Positive L( ) Carnitine + + 107 Positive Leucine + + 108 Positive Methyl isonicotinate + + 109 Positive N Methyl D aspartic acid (NMDA) + + 110 Positive Salicylamide + + 111 Positive Trigonelline + + 112 Positive Metolachlor OXA + + 113 Positive PEG n5 + +

PAGE 87

87 Table 5 1 . Continued . # Polarity Metabolite name Pa Pc Pm M B U 114 Positive 5 Aminovaleric acid + + + 115 Positive Betaine + + + 116 Positive Choline + + + 117 Positive Triisopropanolamine + + + 118 Positive Valine + + + 119 Positive Oleamide + + + + 120 Positive 4 tert Butylcyclohexyl acetate + + 121 Positive N,N Diisopropylethylamine (DIPEA) + + 122 Positive Oxybenzone + + + 123 Positive Resveratrol + + + 124 Positive Trioxsalen + + + 125 Positive N,N Diethylethanolamine + + 126 Positive 4 Methyl N,N dimethylcathinone + + + 127 Positive DEET + + + 128 Positive Metalaxyl + + + + 129 Positive Benzamide + 130 Positive 2 ({2 [(1 B enzylpiperidin 4 yl) amino] 2 oxoethyl}thio) acetic acid + + 131 Positive 1 Aminocyclohexanecarboxylic acid + + + 132 Positive DL Stachydrine + + + 133 Positive L Phenylalanine + + + + 134 Positive Citrinin + + + + 135 Positive Benzotriazole + + + + 136 Positive Sulcatol + + + + + 137 Positive 2 Hydroxycinnamic acid + + + + + + 138 Positive 3,4 Dihydroxyphenylpropionic acid + + + + + + 139 Positive 4 Coumaric acid + + + + + + 140 Positive Cytosine + + + + + + 141 Positive Ethylenediaminetetraacetic acid (EDTA) + + + + + + 142 Positive Isocytosine + + + + + +

PAGE 88

88 Table 5 1 . Continued . # Polarity Metabolite name Pa Pc Pm M B U 143 Positive N Benzylformamide + + + + + +

PAGE 89

89 C HAPTER 6 CONCLUS ION The results of this Ph.D. project indicate that plant parasitic nematode Pythium association on bermudagrass is complicated and species determined. This study emphasized the importance of accurate disease causal agent identification. A positive Pythium sample does not always mean Pythium is the primary problem on a golf green. Sometim es plant parasitic nematodes instead of Pythium are the primary problem. Both Pythium species identification a nd nematode assay are recommended when a positive Pythium sample is received. It is better to treat nematode s and Pythium together when both of th em present in diseased bermudagrass samples. In the greenhouse disease complex test, different plant parasitic nematodes had different effects on different Pythium species infection on bermudagrass. Belonolaimus longicaudatus reduced the bermudagrass infec tion by Pythium arrhenomanes when nematodes were inoculated ahead of Pythium ; however, it increased the infection by P. catenulatum or P. middletonii . Meloidogyne graminis reduced the bermudagrass infection by P. arrhenomanes or P. catenulatum , and had no effect on the infection by P. middletonii . In the lab attraction test, bermudagrass roots infested with either B. longicaudatus or M. graminis reduced the mycelia growth of the three Pythium spp. to some degree . According to those results, plant parasitic nematodes may induce plant resistance to Pythium spp. The antagonistic effects of plant parasitic nematode inoculated bermudagrass roots on infection and mycelial growth of Pythium isolates in the greenho use and lab tests might be associated with metabolites benzene sulfonic acid and azelaic acid , which presented in nematode inoculated root exudates . Acidic conditions provided by

PAGE 90

90 benzene sulfonic acid may inhibit Pythium mycelia growth. Azelaic acid ind uce s the 1 (AZI1) gene and activates the salicylic acid pathway, which is involved in plant defense responses to pathogen infection. To confirm this hypothesis, additional trials need to be conducted on the nematode effects on the expression of AZI1 gene in b ermudagrass, and the effects of salicylic acid and benzene sulfonic acid on Pythium infection and mycelia growth.

PAGE 91

91 LIST OF REFERENCES Abad, G . , Phillips, J., and Roach, G. 2004. First international workshop for the morphological molecular characterization o f the Straminipiles: Phytophthora and Pythium . Raleigh, North Carolina: North Carolina State University. Abad, Z. G., Shew, H. D., and Lucas, L. T. 1994. Characterization and pathogenicity of Pythium species isolated from turfgrass with symptoms of root a nd crown rot in North Carolina. The Am erican Phytopathology 84: 913 921. Adegbite, A. A., and Adesiyan, S. O. 2005. Root extracts of plants to control root knot nematode on edible soybean. World J ournal of Agricultural Sciences 1:18 21. Agrios, G. N. 2005. Parasitism and disease d evelopment. In G. H. Agrios, ed . Plant Pathology, Fifth Edition. Cambridge, MA: Elsevier Academic Press. Ahmed , D., and Shahab, S. 2007. Studies on interaction of Meloidogyne incognita (Kofoid and White) Chitwood and Fusarium solani (Mart.) Sacc forming a disease complex in lentil ( Lens culinaris Medik.). Archives of Phytopathology and Plant Protection. Available: https://doi.org/10.1080/03235408.2018.1476116 Alfieri, S. A ., Jr., Langdon, K. R., Kimbrough, J. W., El Gholl, N. E., and Wehlburg, C. 1994. Diseases and disorders of plants in Florida. Gainesville, FL: Florida Department of Agricultural and Consumer Services Division of Plant Industry. Anonymous. 2015. The Florid a golf economy full report. Golf 20/20. Available: https://golf2020.com/wp content/uploads/2017/11/fl_golf_full_rpt_sri_final1_16_15.pdf AraÂœjo, M. J. A. M., Bosco, S. de M. G., and Sforcin, J. M. 2016. Pythium insidiosum : inhibitory effects of propolis and geopropolis on hyphal growth. Brazilian Journal of Microbiology, 47:863 869. Available: http:// doi.org/10.1016/j.bjm.2016.06.008 Asif, M., Parihar, K., Rehman, B., Ganie, M. A., A. U., and A. Siddiqui, M. 2014. Bio efficacy of some leaf extracts on the inhibition of egg hatching and mortality of Meloidogyne incognita . Archives of Phytopat hology and Plant Protection 47:1015 1021. Atkinson, G. F. 1892. Some diseases of cotton. Alabama Agricultural Experiment Station Bulletin 41:65. Atkinson, N. J., Lilley, C. J., and Urwin, P. E. 2013. Identification of genes involved in the response of Arabidopsis to simultaneous biotic and abi otic stresses. Plant Physiology 162:2028 2041. Back, M. A., Haydock, P. P. J., and Jenkinson, P. 2002. Disease complexes involving plant parasitic nematodes and soilborne pathogens. Plant Pathology 51: 683 697.

PAGE 92

92 Bais, H. P., Pa rk, S. W., Weir, T. L., Callaway, R. M., and Vivanco, J. M. 2004. How plants communicate using the underground information superh ighway. Trends in Plant Science 9:26 32. Bais, H. P., Walker, T. S., Schweizer, H. P., and Vivanco , J. M. 2002. Root specific elicitation and antimicrobial activity of rosmarinic acid in hairy root cultures of sweet basil ( Ocimum basilicum L.). Pl ant Physiology and Biochemistry 40:9837. Bais, H. P., Weir, T. L., Perry, L. G., Gilroy, S., and Vivanco, J . M. 2006. The role of root exudates in rhizosphere interactions with plants and other organisms. Annual Review of Plant Biology 57:233 266. Bauske, E. M. and Waltz, C. 2013. Influence of turfgrass on human aesthetics and psychology: a review. Acta Horticu lturae 888: 37 41. Beard, J. B. 2002. Turf management for golf courses, second edition. Chelsea: Wiley. Bergeson, G. B. 1972. Concepts of nematode Fungus associations in plant disease complexes: A review. Experimental Parasitology 32: 301 314. Binagwa, P. H., Bonsi, C. K., Msolla, S. N., and Ritte, I. I. 2016. Morphological and molecular identification of Pythium spp. isolated from com mon beans ( Phaseolus vulgaris ) infected with root rot disease. A frican Journal of Plant Science 10: 1 9. Branch, C., Hwang, C., Navarre, D. A., and Williamson, V. M. 2004. Salicylic acid is part of the Mi 1 mediated defense response to root knot nematode in tomato. Molecular Pla nt Microbe Interactions 17:351 356. Brigham, L. A., Michaels, P. J., and Flores, H. E. 1999. Cell specific production and antimicrobial activity of naphthoquinones in roots of Lithospermum erythrorhizon . Plant Physiology 119:417 428. Brodie, B. B., and Cooper, W. E. 1964. Relation of parasitic nematodes to postemergence damping off of cotton. Phytopathology 54:1023 1027. Byrd, D. W., Jr., Kirkpatrick, T., and Barker, K. R. 1983. An improved technique for clearing and staining plant tis sue for detection of n ematodes. Journal of Nematology 14:142 143. Section Record 2: 11 13. a new bermudagrass for golf gr e ens. USGA Green Section Record 2: 8 9. attractant for root knot nematodes in exudates from seedling root tips of two h ost species. Scientific Reports 8:10847.

PAGE 93

93 Christie, J. R. 195 9. Plant Nematodes, Their Bionomics and Control. Jacksonville, FL, USA: The H. & W. B. Drew Company. Couch, H. B. 1995. Pythium blight. In H. B. Couch, ed . Diseases of Turfgra sses. Malabar: R. Krieger Publishing Co . Crow, T. W. 2001. Nematode management for golf courses in Florida. Gainesville FL, University of Florida. Available: http://edis.ifas.ufl.edu/in124 go lf courses. Florida Turf Digest 22: 10 12. Deseager, J., and Noling, J. 2017. Foliar or bud nematodes in Florida strawberries. Gainesville FL, University of Florida . Available: https://edi s.ifas.ufl.edu/pdffiles/IN/IN118400.pdf Djian Caporalino, C., Pijarowski, L., Ponchet, M., Arpin, N., and Favre Bonvin, J. 1991. Acetic acid: a selective nematicidal metabolite from culture filtrates of Paecilomyces Lilacinus (Thom) Samson and Tr ichoderma l ongibrachiatum Rifai. Nematologica 37:101 112. EI Borai, F. E., Duncan, L. W., and Graham, J. H. 2002b. Eggs of Tylenchulus semipenetrans inhibit growth of Phytophthora nicotianae and Fusarium solani in vitro. Journal of Nematology 34:267 272. EI Borai, F. E., Duncan, L. W., and Graham, J. H. 2002 b . Infection of citrus roots by Tylenchulus semipenetrans reduces root infection by Phytophthora nicotianae . Journal of Nematology 34:384 389. Evans , K . , and Haydock , P . P . J . 1993. Inte ractions of nematodes with root rot fungi. In M. Wajid Khan , ed. Nematode Interactions. London, UK: Chapman and Hall . Feng, Y., and Dernoeden, P. H. 1999. Pythium species associated with root dysfunction of creeping bentg rass in Maryland. Plant Disease 83:516 520. Goldberg, N. P., Hawes, M. C., and Stanghellini, M. E. 1989. Specific attraction to and infection of cotton root cap cells by zoospores of Pythium dissotocum . Canadian Journal of Botany 67:1760 1767. Goswami, B. K., and Vijayalakshmi, V. 1986. Nematicidal properties of som e indigenous plant materials against root knot nematode Meloidogyne incognita on tomat o. Indian Journal of Nematology 16:65 68. Gray, F. A., Griffin, G. D., Johnson, D. A., Eckert, J. W., and Kazimir, J. E. 1990. Interrelationships between Meloidogyne hapl a and Phytophthora megasperma f. sp. medicaginis in seedlings damping off and root infection of alfalfa. Phytopathology 80:228 232.

PAGE 94

94 Hackney, R. W., and Dickerson, O. J. 1975. Marigold, castor bean and chrysanthemum as control of Meloidogyne incognita and Pratylenchus alleni . Journal of Nem atology 7:84 90. Harmon, P. F. 2004. Pythium blight on overseeded turfgrass. Gainesville FL, University of Florida . Available: http://edis.ifas.ufl.edu/pdff iles/PP/PP12400.pdf Haydu, J. J., Hodges, A. W., Charles, R. H. 2006, Economic impacts of the turfgrass and lawncare industry in the United States. Gainesville FL, University of Florida . Available: http://edis .ifas.ufl.edu/fe632 Heald, C. M. 1969. Pathogenicity and histopathology of Meloidogyne graminis infecting as roots. Journal of Nematology 1: 31. Hodges, C. F., and Coleman, L. W. 1985. Pythium induced root dysfunction of secondary roots of Ag rostis palustris . Plant Disease 69:336 340. Hodges, A. W., Haydu, J. J., van Blokland, P. J. and Bell, A. P. 1994. Contribution of the turfgrass industry to Florida's economy, 1991 92: A value added approach . Economics Reoprt ER 94 1 . University of Fl orida, Gainesville, FL. Holdeman, Q. L., and Graham, T. W. 1953. The sting nematode breaks resistance to cotton wilt. Phytopathology 43:475. Jenkins, W. R. 1964. A rapid centrifugal flotation technique for separating nematodes from soil. Plant Disease Repo rter 48:692. Jenkins, W. R., and Coursen, B. W. 1957. The effect of root knot nematodes, Meloidogyne incognita acrita and M. hapla , on Fusarium wilt of tom ato. The Plant Disease Reporter 41:182 186. Johnson, A. W., and Littrell, R. H. 1969. Pathogenicity of Pythium aphanidermatum to chrysanthemum in combined inoculations with Belonolaimus longicaudatus or Meloidogyne incognita . Journal of Nematology 2:255 259. Jung, H. W., Tschaplinski, T. J., Wang, L., Glazebrook, J., and Greenberg, J. T. 20 09. Priming in s ystemic plant immunity. Science 324:89 91. Juska. F. V. 1972. Nematodes. a contributing factor to zoysiagrass decline in Maryl and. The Plant Disease Reporter 56:568 572. Kerns, J. P., and Tredway, L. P. 2010. Pythium root dysfunction of creeping bentgrass. Plant Health Progress . Available: https://www.plantmanagementnetwork.org/pub/php/diagnosticguide/2010/pythiu m/p ythium.pdf Khan , M. W. 1993. Mechanisms of interactions between nematode s and other plant pathogens. In M. W. Khan , ed. Nematode Interactions. Dordrecht: Springer .

PAGE 95

95 Khan, N., Bano, A., Rahman, M. A., Rathinasabapathi, B., and Babar, M. A. 2018. UPLC HRMS based untargeted metabolic profiling reveals changes in chickpea ( Cicer arietinum ) metabolome following long term drought stress. Plant, Cell & Environment. Available: https://doi.org/10. 1111/pce.13195 Klemsdal, S. S., Herrero, M. L., Wanner, L. A., Lund, G. and Hermansen, A. 2008. PCR based identification of Pythium spp. causing cavity spot in carrots and sensitive detection i n soil samples. Plant Pathology 57: 877 886. Lambert, K. N., Ferrie, B. J., Nombela, G., Brenner, E. D., and Williamson, V. M. 1999. Identification of genes whose transcripts accumulate rapidly in tomato after root knot nematode infection. Physiological and Molecular Plant Pathology 55:341 348. Lamichhane, J. R. and Venturi, V. 2015. Synergisms between microbial pathogens in plant disease complexes: a growing trend. Frontiers in Plant Science 6: 385. Le May, C., Potage, G, Andrivon, D., Tivoli, B., and Outreman, Y. 2009. Plant disease complex: antagonism and synergism between pathogens of the Ascochyta blight complex on pea. Journal of Phytopathology 157:715 721. Levesque, C. A., and de Cock, A. W. A. M. 2004. Molecular phylogeny and taxonomy of the genus Pythium . Mycological Research 108:1363 1383. Lucas, L. T., and M udge, L. C. 1997. Fungicidal compositions for the enhancement of turf quality. United States Patent 5643852. Available: https://patentimages.storage.googleapi s.com/e8/e6/bd/07b87b0c01485d/US5643 852.pdf Lukens, R. J., and Miller, P. M. 1973. Injury to turf grasses by Tylenchorhynchus dubius and Hoplolaimus spp. Phytopathology 63: 204. Lyman, G. T., Throssell, C. S., Johnson, M. E., Stacey, G. A., and Brown, C. D. 2007. Golf course profile describes turfgrass, landscape and environmental stewardship features. Applied Turfgrass Science. Available: https://dl.sciencesocieti es.org/publications/ats/abstracts/4/1/2007 1107 01 RS Mai, W. F., and Abawi, G. S. 1987. Interac tions among root knot nematodes and Fusarium wilt fungi on host plants. Annu al Review of Phytopathology 25: 317 38. Manosalva, P., Manohar, M., von Reu ss, S. H., Chen, S., Koch, A., Kaplan, F., Choe, A., Micikas, R. J., Wang, X., Kogel, K., Sternberg, P. W., Williamson, V. M., Schroeder, F. C., and Klessig, D. F. 2015. Conserved nematode signalling molecules elicit plant defenses and pathogen re sistance. Nature Communications 6:7795 .

PAGE 96

96 Matsuzaki, F., Shimizu, M., and Wariishi, H. 2008. Proteomic and metabolomic analyses of the white rot fungus Phanerochaete chrysosporium exposed to exogenous benzoic acid. Journal of Proteome Research 7:2342 2350. Milesi, C. , Running, S. W., Elvidge, C. D., Dietz, J. B., Tuttle, B. T. and Nemani, R. R. 2005. Mapping and modeling the biogeochemical cycling of turf grasses in the United S tates. Environmental Management 36: 426 438. Minton, N. A., and Minton, E. B. 1966. Effect o f root knot and sting nematodes on expression of Fusarium wilt of cotton in three soils. Phytopathology 56:319 322. Morris, K. 2003. The national turfgrass research initiative. Available: h ttp://www.turfresearch.org/pdf/turfinitiative.pdf Morris, K. A., Langston, D. B., Dutta, B., Davis, R. F., Timper, P., Noe, J. P., and Dickson, D. W. 2016. Evidence for a disease complex between Pythium aphanidermatum and root knot nematodes in cucumber. Plant Health Progress 17:200 201. Mountain, W. B., and McKeen, C. D. 1962. Effect of Verticillium dahliae on the population of Pratylenchus penetrans . Nematologica 7:261 66. Nelson, E. B., and Craft, C. M. 1991. Identification and comparative pathogenicity of Pythium spp. from roots and crowns of turfgrasses exhibiting sympt oms of root rot. Phytopathology 81:1529 1536. Nicol, R. W., Yousef, L., Traquair, J. A., and Bernards, M . A. 2003. Ginsenosides stimulate the growth of soilborne pathogens of A merican ginseng. Phytochemistry 64:257 264. Olthof, T. H. A., and Reynes, A. A. 1969. Effect of Pratylenchus penetrans on Verticillium wilt o f pepper. Journal of Nematology 1:21 22 (Ab str.). Pang, W., Crow, W. T., Luc, J. E., McSorley, R., Giblin Davis, R. M., Kenworthy, K. E., and Kruse, J. K. 2011. Comparison of water displacement and WinRHIZO software for plant root parameter assessment. Plant Disease 95:1308 1310. Pitcher, R. S. 196 5. Interrelationships of nematodes and other pathogens of pl ants. Helminthological Abstract 34: 1 17. Pitcher, R. S. 1978. Interactions of nematodes with other pa thogens. I n J. F. Southey, ed. Pl ant Nematology. . Powel l, N. T. 1963. The role of plant parasiti c nematodes in fungus diseases. Phytopathology 53 : 28 35. Powell, N. T. 1971 a . Interactions between nematodes and fungi in disease complexes. Annual Review of Phytopathology 9:253 274.

PAGE 97

97 Powell, N. T. 1971b. Interacti on of plant parasitic nematodes wi th other disease causing agents. I n B. M. Zuckerman, W. F. Mai and R. A. Rohde, eds. Plant Parasitic Nematodes , Vol. II . New York: Academic P ress . Reasor, E. H., Brosnan, J. T., Trigiano, R. N., Elsner, J. E., Henry, G. M., and Schwartz, B. M. 2016. The genetic and phenotypic variability of interspecific hybrid bermudagrasses ( Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt Davy) used on gol f course putting greens. Planta 244: 761 773. Robideau, G. P., De Cock, A. W ., Coffey, M. D., Voglmayr, H., Brouwer, H., Bala, K., Chitty, D. W., Desaulniers, N., Eggertson, Q. A., Gachon, C. M., Hu, C., Kupper, F. C., Rintoul, T. L., Sarhan, E., Verstappen, E. C., Zhang, Y., Bonants, P. J., Ristaino, J. B. and Levesque, A. C. 201 1. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Molecular Ecology Resources 11:1002 1011. Royle, D. J., and Hickman, C. J. 1964. Analysis of factors governing in vitro accumulation of zoospores of Pythium aphanidermatum on roots: I. Behavior of zoospores. C anadian Journal of Microbiology 10:151 162. Seo, Y., and Kim, Y. H. 2014. Control of Meloidogyne incognita Using Mixtures of Organic Acids. Plant Pathology Journal 30:450 455. Shokoohi, E., and Duncan, L . W. 2018. N ematode parasites of citrus. In R. A. Sikora, D. Coyne, J. Hallmann, and P, Timper, eds. Plant Parasitic Nematodes in Subtropical and Tropical Agriculture, Third Edition. Boston, MA: CABI. Sikder, M. M., Gheysen, G., Hšfte, M., Kyndt, T., and V erbeek, R. 2015. The analysis of Pythium arrhenomanes Meloidogyne graminicola infection on rice. University Gent. Available: https://lib.ugent.be/fulltxt/RUG01/ 002/213/982/RUG01 002213982_2015_0001_AC.pdf Smiley, R. W., Dernoeden, P. H., and Clarke, B. B. 2005. Compendium of turfgrass diseases, third edition. St. Paul, Minnesota: APS Press. Smith, J. D., Jackson, N., and Woolhouse, A. R. 1989. Fungal diseases of amenity turf grasses. New York, N.Y.: E. & F. N. Spon, Ltd. Stiles, C. M., Datnoff, L. E., and Rayside, P. A. 2007. Pythium spp. isolated from bermudagrass during overseed transitions in Florida and pathogenicity of Pythium irregulare on Poa trivialis . Plant Disease 91:1237 1244. Taylor, C. E. 1979. Meloidogyne interre lationships with microorganisms. I n F. Lamberti and C. E. Taylor, eds . Root Knot Nematodes ( Meloidogyne Species) Systematics, Biology and Control . London: Academic Press . USGA green section staff. 2018.USGA recommendations for a method of golf green construction, 2018 revision. Available:

PAGE 98

98 http://archive.lib.msu.edu/tic/usgamisc/monos/2018r ecommendationsmethodputti nggreen.pdf Valle Lamboy, S., and Ayala, A. 1980. Pathogenicity of Meloidogyne incognita and Pratylenchus zeae , and their association with Pythium graminicola on roots of sugarcane in Puerto Rico. Journal of Agriculture of University of Puerto Rico 64:338 347. Van der Plaats Niterink, A. J. 1981. Monograph of the genus Pythium . Studies in Myc ology 21:1 244. Verbeek, R. E. M., Banaay, C. G., Sikder, M., De Waele , D., Vera Cruz, C. M., Gheysen, G., Hšfte, M., and Kyndt, T. 2016. Interactions between the oomycete Pythium arrhenomanes and the rice root knot nematode Meloidogyne graminicola in aerobic Asian rice varieties. Rice 9:36. Wang, C., Lower, S., and Williams on, V. M. 2009. Application of Pluronic gel to the study of root knot nematode behavior. Nematology 11:453 464. White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M . A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds. PCR Protocols. A Guide to Methods and Applications. New York, USA: Academic Press. Williamson, V. M., and Gleason, C. A. 2003. Plant nematode interactions. Current Opinion in Plant Biology 6:3 27 333. Zhou, T., and Paulitz, T. C. 1993. In vitro and in vivo effects of Pseudomonas spp. on Pythium aphanidermatum : zoospore behavior in exudates and on the rhizosplane of bacteria treated cucumber roots. Phytopathology 83:872 876.

PAGE 99

99 BIOGRAPHICAL SKETCH Mengyi Gu graduated from Northeast Agricultural University with a Bachelor of Science degree in Landscape in 2012. In the same year, she also graduated from the Michigan State University China Turf Program with a Bachelor of Science degree in Turfgrass Management. In fall 2011, she did her internship at the Jimmie Austin University of Oklahoma Golf Club, No rman, OK, where a love of turfgrass management was born. She relocated to Gainesville, FL, to join the Un iversity of Florida and to pursue the Master of Science and Doctor of Philosophy degrees in the Entomology and Nematology Department in 2012. Mengyi accepted her Master in the field of nematology and ke p t on working with her PhD in the same lab . In May 2019 , s he received her PhD with the dissertation Bermudagrass root rot complexes associated with plant parasitic nematodes and Pythium species on golf course s